SRY (NM_003140) Human Untagged Clone
CAT#: SC303278
SRY (untagged)-Human sex determining region Y (SRY)
CNY 3600.00
Product images
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | SRXX1; SRXY1; TDF; TDY | 
| Vector | pCMV6 series | 
| Sequence Data | 
                
                
                
                 >NCBI ORF sequence for NM_003140, the custom clone sequence may differ by one or more nucleotides 
ATGCAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGA ATATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGA AACGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGG TCTCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGC TGGGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACA GGCCATGCACAGAGAGAAATACCCGAATTATAAGTATCGACCTCGTCGGAAGGCGAAGATGCTGCCGAAG AATTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGT ACAGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAA CGCAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAG  | 
        
| Restriction Sites | Please inquire | 
| ACCN | NM_003140 | 
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info  | 
        
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_003140.1, NP_003131.1 | 
| RefSeq Size | 897 bp | 
| RefSeq ORF | 615 bp | 
| Locus ID | 6736 | 
| UniProt ID | Q05066 | 
| Gene Summary | This intronless gene encodes a transcription factor that is a member of the high mobility group (HMG)-box family of DNA-binding proteins. This protein is the testis-determining factor (TDF), which initiates male sex determination. Mutations in this gene give rise to XY females with gonadal dysgenesis (Swyer syndrome); translocation of part of the Y chromosome containing this gene to the X chromosome causes XX male syndrome. [provided by RefSeq, Jul 2008] | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC210382 | SRY (Myc-DDK-tagged)-Human sex determining region Y (SRY) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 3600.00  | 
                                            |
| RC210382L1 | Lenti ORF clone of Human sex determining region Y (SRY), Myc-DDK-tagged | 
                                                     CNY 6000.00  | 
                                            |
| RC210382L2 | Lenti ORF clone of Human sex determining region Y (SRY), mGFP tagged | 
                                                     CNY 6000.00  | 
                                            |
| RC210382L3 | Lenti ORF clone of Human sex determining region Y (SRY), Myc-DDK-tagged | 
                                                     CNY 6000.00  | 
                                            |
| RC210382L4 | Lenti ORF clone of Human sex determining region Y (SRY), mGFP tagged | 
                                                     CNY 6000.00  | 
                                            |
| RG210382 | SRY (tGFP-tagged) - Human sex determining region Y (SRY) | 
                                                     CNY 5200.00  | 
                                            
