CCN4 (NM_003882) Human Untagged Clone
CAT#: SC303397
WISP1 (untagged)-Human WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1
CNY 5488.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | WISP1; WISP1-OT1; WISP1-UT1; WISP1c; WISP1i; WISP1tc |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_003882 edited
GTCGATGCCTGTGCCACTGACGTCCAGGCATGAGGTGGTTCCTGCCCTGGACGCTGGCAG CAGTGACAGCAGCAGCCGCCAGCACCGTCCTGGCCACGGCCCTCTCTCCAGCCCCTACGA CCATGGACTTTACCCCAGCTCCACTGGAGGACACCTCCTCACGCCCCCAATTCTGCAAGT GGCCATGTGAGTGCCCGCCATCCCCACCCCGCTGCCCGCTGGGGGTCAGCCTCATCACAG ATGGCTGTGAGTGCTGTAAGATGTGCGCTCAGCAGCTTGGGGACAACTGCACGGAGGCTG CCATCTGTGACCCCCACCGGGGCCTCTACTGTGACTACAGCGGGGACCGCCCGAGGTACG CAATAGGAGTGTGTGCACAGGTGGTCGGTGTGGGCTGCGTCCTGGATGGGGTGCGCTACA ACAACGGCCAGTCCTTCCAGCCTAACTGCAAGTACAACTGCACGTGCATCGACGGCGCGG TGGGCTGCACACCACTGTGCCTCCGAGTGCGCCCCCCGCGTCTCTGGTGCCCCCACCCGC GGCGCGTGAGCATACCTGGCCACTGCTGTGAGCAGTGGGTATGTGAGGACGACGCCAAGA GGCCACGCAAGACCGCACCCCGTGACACAGGAGCCTTCGATGCTGTGGGTGAGGTGGAGG CATGGCACAGGAACTGCATAGCCTACACAAGCCCCTGGAGCCCTTGCTCCACCAGCTGCG GCCTGGGGGTCTCCACTCGGATCTCCAATGTTAACGCCCAGTGCTGGCCTGAGCAAGAGA GCCGCCTCTGCAACTTGCGGCCATGCGATGTGGACATCCATACACTCATTAAGGCAGGGA AGAAGTGTCTGGCTGTGTACCAGCCAGAGGCATCCATGAACTTCACACTTGCGGGCTGCA TCAGCACACGCTCCTATCAACCCAAGTACTGTGGAGTTTGCATGGACAATAGGTGCTGCA TCCCCTACAAGTCTAAGACTATCGACGTGTCCTTCCAGTGTCCTGATGGGCTTGGCTTCT CCCGCCAGGTCCTATGGATTAATGCCTGCTTCTGTAACCTGAGCTGTAGGAATCCCAATG ACATCTTTGCTGACTTGGAATCCTACCCTGACTTCTCAGAAATTGCCAACTAGGCAGGCA CAAATCTTGGGTCT |
| Restriction Sites | Please inquire |
| ACCN | NM_003882 |
| Insert Size | 1150 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003882.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003882.2, NP_003873.1 |
| RefSeq Size | 2819 bp |
| RefSeq ORF | 1104 bp |
| Locus ID | 8840 |
| UniProt ID | O95388 |
| Domains | IB, tsp_1, VWC, CT, Cys_knot |
| Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Secreted Protein, Stem cell relevant signaling - DSL/Notch pathway, Stem cell relevant signaling - Wnt Signaling pathway |
| Gene Summary | This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (1) encodes the full length protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Identification of a novel lncRNA induced by the nephrotoxin ochratoxin A and expressed in human renal tumor tissue
,Polovic, M;Dittmar, S;Hennemeier, I;Humpf, HU;Seliger, B;Fornara, P;Theil, G;Azinovic, P;Nolze, A;Köhn, M;Schwerdt, G;Gekle, M;,
Cell. Mol. Life Sci.
,PubMed ID 29282485
[CCN4]
|
|
miR-92a regulates TGF-ß1-induced WISP1 expression in pulmonary fibrosis
,Berschneider, B;Ellwanger, DC;Baarsma, HA;Thiel, C;Shimbori, C;White, ES;Kolb, M;Neth, P;Königshoff, M;,
Int. J. Biochem. Cell Biol.
,PubMed ID 24953558
[CCN4]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210402 | WISP1 (Myc-DDK-tagged)-Human WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1 |
CNY 5488.00 |
|
| RC210402L1 | Lenti ORF clone of Human WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1, Myc-DDK-tagged |
CNY 7888.00 |
|
| RC210402L2 | Lenti ORF clone of Human WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC210402L3 | Lenti ORF clone of Human WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC210402L4 | Lenti ORF clone of Human WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG210402 | WISP1 (tGFP-tagged) - Human WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 1 |
CNY 7088.00 |
