Precerebellin (CBLN1) (NM_004352) Human Untagged Clone

CAT#: SC303471

CBLN1 (untagged)-Human cerebellin 1 precursor (CBLN1)



  "NM_004352" in other vectors (6)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CBLN1 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303471 representing NM_004352.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGGCGTCCTGGAGCTGCTGCTGCTGGGGGCTGCGTGGCTGGCGGGCCCGGCCCGCGGGCAGAAT
GAGACGGAGCCCATCGTGCTGGAGGGCAAGTGCCTGGTGGTGTGCGACTCCAACCCCACGTCCGACCCC
ACGGGCACTGCCCTGGGCATCTCTGTGCGCTCTGGCAGCGCCAAGGTGGCTTTCTCTGCCATCAGGAGC
ACCAACCACGAGCCGTCCGAGATGAGTAATCGCACCATGATCATCTACTTCGACCAGGTACTAGTGAAC
ATTGGGAACAACTTTGATTCAGAACGCAGCACTTTCATCGCCCCGCGCAAAGGGATCTACAGTTTTAAC
TTCCACGTGGTAAAAGTCTACAACAGACAAACCATACAGGTGAGCCTCATGCTAAACGGGTGGCCGGTG
ATTTCAGCCTTCGCTGGTGACCAGGACGTGACCCGGGAGGCCGCCAGCAACGGAGTCCTAATCCAAATG
GAGAAAGGCGACCGAGCATACCTCAAGCTGGAGCGGGGAAACTTGATGGGGGGCTGGAAGTACTCGACC
TTCTCCGGATTCCTGGTGTTTCCTCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_004352
Insert Size 582 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004352.3
RefSeq Size 2435 bp
RefSeq ORF 582 bp
Locus ID 869
UniProt ID P23435
Protein Families Secreted Protein
MW 21.1 kDa
Gene Summary This gene encodes a cerebellum-specific precursor protein, precerebellin, with similarity to the globular (non-collagen-like) domain of complement component C1qB. Precerebellin is processed to give rise to several derivatives, including the hexadecapeptide, cerebellin, which is highly enriched in postsynaptic structures of Purkinje cells. Cerebellin has also been found in human and rat adrenals, where it has been shown to enhance the secretory activity of this gland. [provided by RefSeq, Aug 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...