SFTPA1 (NM_005411) Human Untagged Clone
CAT#: SC303638
SFTPA1 (untagged)-Human surfactant protein A1 (SFTPA1), transcript variant 1
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | COLEC4; PSAP; PSP-A; PSPA; SFTP1; SFTPA1B; SP-A; SP-A1; SP-A1 beta; SP-A1 delta; SP-A1 epsilon; SP-A1 gamma; SPA; SPA1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_005411 edited
GCAGCTGGAGGCTCTGTGTGTGGGAGCAGCGACTGGACCCAGAGCCATGTGGCTGTGCCC TCTGGCCCTCAACCTCATCTTGATGGCAGCCTCTGGTGCTGTGTGCGAAGTGAAGGACGT TTGTGTTGGAAGCCCTGGTATCCCCGGCACTCCTGGATCCCACGGCCTGCCAGGCAGGGA CGGGAGAGATGGTCTCAAAGGAGACCCTGGCCCTCCAGGCCCCATGGGTCCACCTGGAGA AATGCCATGTCCTCCTGGAAATGATGGGCTGCCTGGAGCCCCTGGTATCCCTGGAGAGTG TGGAGAGAAGGGGGAGCCTGGCGAGAGGGGCCCTCCAGGGCTTCCAGCTCATCTAGATGA GGAGCTCCAAGCCACACTCCACGACTTTAGACATCAAATCCTGCAGACAAGGGGAGCCCT CAGTCTGCAGGGCTCCATAATGACAGTAGGAGAGAAGGTCTTCTCCAGCAATGGGCAGTC CATCACTTTTGATGCCATTCAGGAGGCATGTGCCAGAGCAGGCGGCCGCATTGCTGTCCC AAGGAATCCAGAGGAAAATGAGGCCATTGCAAGCTTCGTGAAGAAGTACAACACATATGC CTATGTAGGCCTGACTGAGGGTCCCAGCCCTGGAGACTTCCGCTACTCAGACGGGACCCC TGTAAACTACACCAACTGGTACCGAGGGGAGCCCGCAGGTCGGGGAAAAGAGCAGTGTGT GGAGATGTACACAGATGGGCAGTGGAATGACAGGAACTGCCTGTACTCCCGACTGACCAT CTGTGAGTTCTGAGAGGCATTTAGGCCATGGGACA |
Restriction Sites | Please inquire |
ACCN | NM_005411 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005411.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005411.3, NP_005402.3 |
RefSeq Size | 968 bp |
RefSeq ORF | 747 bp |
Locus ID | 653509 |
UniProt ID | Q8IWL2 |
Gene Summary | This gene encodes a lung surfactant protein that is a member of a subfamily of C-type lectins called collectins. The encoded protein binds specific carbohydrate moieties found on lipids and on the surface of microorganisms. This protein plays an essential role in surfactant homeostasis and in the defense against respiratory pathogens. Mutations in this gene are associated with idiopathic pulmonary fibrosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 3 and 4 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220332 | SFTPA1 (Myc-DDK-tagged)-Human surfactant protein A1 (SFTPA1), transcript variant 1 |
CNY 2400.00 |
|
RC220332L1 | Lenti ORF clone of Human surfactant protein A1 (SFTPA1), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC220332L2 | Lenti ORF clone of Human surfactant protein A1 (SFTPA1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC220332L3 | Lenti ORF clone of Human surfactant protein A1 (SFTPA1), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC220332L4 | Lenti ORF clone of Human surfactant protein A1 (SFTPA1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG220332 | SFTPA1 (tGFP-tagged) - Human surfactant protein A1 (SFTPA1), transcript variant 1 |
CNY 4370.00 |