SPRR1A (NM_005987) Human Untagged Clone
CAT#: SC303714
SPRR1A (untagged)-Human small proline-rich protein 1A (SPRR1A), transcript variant 2
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SPRK |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_005987 edited
CCAAGGGACCACACAGCCCATTCTGCTCCGTATACCAGAAAAAAACACATTTGAAGCATG AATTCTCAGCAGCAGAAGCAGCCTTGCACCCCACCCCCTCAGCCTCAGCAGCAGCAGGTG AAACAACCTTGCCAGCCTCCACCCCAGGAACCATGCATCCCCAAAACCAAGGAGCCCTGC CAACCCAAGGTGCCTGAGCCCTGCCACCCCAAAGTGCCTGAGCCCTGCCAGCCCAAGATT CCAGAGCCCTGCCAGCCCAAGGTGCCTGAGCCCTGCCCTTCAACGGTCACTCCAGCACCA GCCCAGCAGAAGACCAAGCAGAAGTAATGTGGTCCACAGCCATGCCCTTGAGGAGCTGGC C |
| Restriction Sites | Please inquire |
| ACCN | NM_005987 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to differ from the protein associated to this reference by two amino acids. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005987.2, NP_005978.2 |
| RefSeq Size | 664 bp |
| RefSeq ORF | 270 bp |
| Locus ID | 6698 |
| UniProt ID | P35321 |
| Gene Summary | Cross-linked envelope protein of keratinocytes. It is a keratinocyte protein that first appears in the cell cytosol, but ultimately becomes cross-linked to membrane proteins by transglutaminase. All that results in the formation of an insoluble envelope beneath the plasma membrane.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) has an alternate splice site, resulting in a shorter 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211258 | SPRR1A (Myc-DDK-tagged)-Human small proline-rich protein 1A (SPRR1A), transcript variant 2 |
CNY 1200.00 |
|
| RC211258L1 | Lenti ORF clone of Human small proline-rich protein 1A (SPRR1A), transcript variant 2, Myc-DDK-tagged |
CNY 3600.00 |
|
| RC211258L2 | Lenti ORF clone of Human small proline-rich protein 1A (SPRR1A), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RC211258L3 | Lenti ORF clone of Human small proline-rich protein 1A (SPRR1A), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC211258L4 | Lenti ORF clone of Human small proline-rich protein 1A (SPRR1A), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG211258 | SPRR1A (tGFP-tagged) - Human small proline-rich protein 1A (SPRR1A), transcript variant 2 |
CNY 2800.00 |
