PDE6H (NM_006205) Human Untagged Clone
CAT＃: SC303750
PDE6H (untagged)-Human phosphodiesterase 6H, cGMP-specific, cone, gamma (PDE6H)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACHM6; RCD3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303750 representing NM_006205.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTGACAACACTACTCTGCCTGCTCCAGCTTCAAACCAGGGTCCTACCACCCCACGCAAAGGCCCT CCCAAGTTCAAGCAGAGGCAGACTCGCCAATTCAAGAGTAAACCTCCAAAGAAAGGTGTGAAAGGATTT GGAGATGACATTCCAGGAATGGAGGGGCTAGGAACAGATATCACAGTGATTTGTCCATGGGAGGCATTC AGCCACCTGGAATTGCATGAGCTCGCTCAGTTTGGGATTATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_006205 |
| Insert Size | 252 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006205.2 |
| RefSeq Size | 763 bp |
| RefSeq ORF | 252 bp |
| Locus ID | 5149 |
| UniProt ID | Q13956 |
| Protein Pathways | Progesterone-mediated oocyte maturation, Purine metabolism |
| MW | 9.1 kDa |
| Gene Summary | This gene encodes the inhibitory (or gamma) subunit of the cone-specific cGMP phosphodiesterase, which is a tetramer composed of two catalytic chains (alpha and beta), and two inhibitory chains (gamma). It is specifically expressed in the retina, and is involved in the transmission and amplification of the visual signal. Mutations in this gene are associated with retinal cone dystrophy type 3A (RCD3A). [provided by RefSeq, Mar 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210215 | PDE6H (Myc-DDK-tagged)-Human phosphodiesterase 6H, cGMP-specific, cone, gamma (PDE6H) |
CNY 1200.00 |
|
| RC210215L3 | Lenti ORF clone of Human phosphodiesterase 6H, cGMP-specific, cone, gamma (PDE6H), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC210215L4 | Lenti ORF clone of Human phosphodiesterase 6H, cGMP-specific, cone, gamma (PDE6H), mGFP tagged |
CNY 5890.00 |
|
| RG210215 | PDE6H (tGFP-tagged) - Human phosphodiesterase 6H, cGMP-specific, cone, gamma (PDE6H) |
CNY 2800.00 |
