BOB1 (POU2AF1) (NM_006235) Human Untagged Clone
CAT#: SC303755
POU2AF1 (untagged)-Human POU class 2 associating factor 1 (POU2AF1)
CNY 2400.00
CNY 3990.00
Cited in 1 publication. |
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BOB1; OBF-1; OBF1; OCAB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_006235, the custom clone sequence may differ by one or more nucleotides
ATGCTCTGGCAAAAACCCACAGCTCCGGAGCAAGCCCCAGCCCCGGCCCGGCCATACCAGGGCGTCCGTG TGAAGGAGCCAGTGAAGGAACTGCTGAGGAGGAAGCGAGGCCACGCCAGCAGTGGGGCAGCACCTGCACC TACGGCGGTGGTGCTGCCCCATCAGCCCCTGGCGACCTACACCACAGTGGGTCCTTCCTGCCTGGACATG GAAGGTTCTGTGTCTGCAGTGACAGAGGAGGCTGCCCTGTGTGCCGGCTGGCTCTCCCAGCCCACCCCGG CCACCCTGCAGCCCCTGGCCCCATGGACACCTTACACCGAGTATGTGCCCCATGAAGCTGTCAGCTGCCC CTACTCAGCTGACATGTATGTGCAGCCCGTGTGCCCCAGCTACACGGTGGTGGGGCCCTCCTCAGTGTTG ACCTATGCCTCTCCGCCACTCATCACCAATGTCACGACAAGAAGCTCCGCCACGCCCGCAGTGGGGCCCC CGCTGGAGGGCCCAGAGCACCAGGCACCCCTCACCTATTTCCCGTGGCCTCAGCCCCTTTCCACACTACC CACCTCCACCCTGCAGTACCAGCCTCCGGCCCCAGCCCTACCTGGGCCCCAGTTTGTCCAGCTCCCCATC TCTATCCCAGAGCCAGTCCTTCAGGACATGGAAGACCCCAGAAGAGCCGCCAGCTCGTTGACCATCGACA AGCTGCTTTTGGAGGAAGAGGATAGCGACGCCTATGCGCTTAACCACACTCTCTCTGTGGAAGGCTTTTA G |
Restriction Sites | Please inquire |
ACCN | NM_006235 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006235.1, NP_006226.1 |
RefSeq Size | 3314 bp |
RefSeq ORF | 771 bp |
Locus ID | 5450 |
UniProt ID | Q16633 |
Gene Summary | Transcriptional coactivator that specifically associates with either OCT1 or OCT2. It boosts the OCT1 mediated promoter activity and to a lesser extent, that of OCT2. It has no intrinsic DNA-binding activity. It recognizes the POU domains of OCT1 and OCT2. It is essential for the response of B-cells to antigens and required for the formation of germinal centers.[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Regulation of normal B-cell differentiation and malignant B-cell survival by OCT2
,Hodson, DJ;Shaffer, AL;Xiao, W;Wright, GW;Schmitz, R;Phelan, JD;Yang, Y;Webster, DE;Rui, L;Kohlhammer, H;Nakagawa, M;Waldmann, TA;Staudt, LM;,
Proc. Natl. Acad. Sci. U.S.A.
,PubMed ID 26993806
[POU2AF1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207562 | POU2AF1 (Myc-DDK-tagged)-Human POU class 2 associating factor 1 (POU2AF1) |
CNY 2400.00 |
|
RC207562L3 | Lenti ORF clone of Human POU class 2 associating factor 1 (POU2AF1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC207562L4 | Lenti ORF clone of Human POU class 2 associating factor 1 (POU2AF1), mGFP tagged |
CNY 4800.00 |
|
RG207562 | POU2AF1 (tGFP-tagged) - Human POU class 2 associating factor 1 (POU2AF1) |
CNY 4000.00 |