RAX (NM_013435) Human Untagged Clone

CAT#: SC304009

RAX (untagged)-Human retina and anterior neural fold homeobox (RAX)



  "NM_013435" in other vectors (6)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RAX mouse monoclonal antibody,clone OTI1C5
    • 100 ul

CNY 1999.00
CNY 2700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MCOP3; RX
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene ORF sequence for NM_013435 edited
ATGCACCTGCCGGGCTGCGCGCCAGCCATGGCCGACGGGAGCTTCTCGCTTGCCGGCCAC
CTGCTCCGCAGCCCGGGCGGGAGCACCTCGCGACTTCACAGCATCGAGGCCATCCTGGGG
TTTACCAAGGACGACGGGATCCTCGGCACCTTCCCGGCGGAGCGGGGCGCCCGGGGCGCG
AAGGAGCGGGATAGGAGGCTGGGCGCGCGGCCCGCCTGCCCCAAGGCGCCCGAGGAAGGC
TCCGAGCCCTCCCCGCCGCCAGCCCCGGCGCCCGCCCCCGAGTACGAAGCCCCTCGACCC
TACTGCCCCAAGGAGCCCGGGGAGGCACGGCCGAGCCCAGGGCTGCCCGTCGGGCCAGCC
ACCGGCGAAGCGAAACTGTCAGAGGAGGAACAGCCCAAGAAAAAGCATCGGCGGAACCGC
ACGACTTTCACCACGTACCAGCTGCATGAGCTGGAGCGCGCGTTCGAGAAGTCCCACTAC
CCGGACGTGTACAGCCGCGAGGAGCTGGCCGGCAAGGTCAACCTACCAGAGGTCCGGGTC
CAGGTGTGGTTCCAGAACCGACGGGCTAAGTGGCGGCGGCAGGAGAAGCTGGAAGTGTCC
TCCATGAAGCTGCAGGACTCGCCCCTCCTCTCCTTCAGCCGCTCCCCGCCCTCCGCGACG
CTGTCGCCCCTCGGGGCGGGCCCGGGCAGCGGTGGCGGGCCGGCTGGGGGCGCGCTGCCG
CTGGAGTCCTGGCTCGGGCCGCCGCTGCCGGGCGGGGGCGCCACGGCGCTGCAGAGCCTG
CCGGGCTTCGGGCCGCCGGCGCAGAGCCTGCCTGCCAGCTACACGCCACCGCCGCCGCCT
CCGCCCTTCCTGAACTCCCCGCCGTTGGGCCCCGGCCTGCAACCTCTCGCGCCGCCGCCG
CCCTCCTACCCGTGCGGGCCCGGCTTCGGGGACAAGTTCCCGCTGGACGAGGCGGACCCG
CGCAACAGCAGCATCGCGGCGCTGCGTCTGAAAGCCAAGGAGCACATCCAGGCCATCGGG
AAGCCGTGGCAGGCCCTCTAG
Restriction Sites Please inquire     
ACCN NM_013435
Insert Size 1000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_013435.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013435.1, NP_038463.1
RefSeq Size 1775 bp
RefSeq ORF 1041 bp
Locus ID 30062
UniProt ID Q9Y2V3
Protein Families Druggable Genome
Gene Summary This gene encodes a homeobox-containing transcription factor that functions in eye development. The gene is expressed early in the eye primordia, and is required for retinal cell fate determination and also regulates stem cell proliferation. Mutations in this gene have been reported in patients with defects in ocular development, including microphthalmia, anophthalmia, and coloboma.[provided by RefSeq, Oct 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...