SPANXA1 (NM_013453) Human Untagged Clone
CAT＃: SC304011
SPANXA1 (untagged)-Human sperm protein associated with the nucleus, X-linked, family member A1 (SPANXA1)
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT11.1; CT11.3; NAP-X; SPAN-X; SPAN-Xa; SPAN-Xb; SPANX; SPANX-A |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_013453 edited
AAGCCTGCCACTGACATTGAAGAACCAATATATACAATGGACAAACAATCCAGTGCCGGC GGGGTGAAGAGGAGCGTCCCCTGTGATTCCAACGAGGCCAACGAGATGATGCCGGAGACC CCAACTGGGGACTCAGACCCGCAACCTGCTCCTAAAAAAATGAAAACATCTGAGTCCTCG ACCATACTAGTGGTTCGCTACAGGAGGAACTTTAAAAGAACATCTCCAGAGGAACTGCTG AATGACCACGCCCGAGAGAACAGAATCAACCCCCTCCAAATGGAGGAGGAGGAATTCATG GAAATAATGGTTGAAATACCTGCAAAGTAGCAAGAAGCTACATCTCTCAACCTTGGGCAA TGAAAATAAAGTTTGAGAAG |
| Restriction Sites | Please inquire |
| ACCN | NM_013453 |
| Insert Size | 400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_013453.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_013453.2, NP_038481.2 |
| RefSeq Size | 384 bp |
| RefSeq ORF | 294 bp |
| Locus ID | 30014 |
| UniProt ID | Q9NS26 |
| Gene Summary | Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene maps to chromosome X in a head-to-head orientation with SPANX family member A2, which appears to be a duplication of the A1 locus. The protein encoded by this gene targets to the nucleus where it associates with nuclear vacuoles and the redundant nuclear envelope. Based on its association with these poorly characterized regions of the sperm nucleus, this protein provides a biochemical marker to study unique structures in spermatazoa while attempting to further define its role in spermatogenesis. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211653 | SPANXA1 (Myc-DDK-tagged)-Human sperm protein associated with the nucleus, X-linked, family member A1 (SPANXA1) |
CNY 1200.00 |
|
| RC211653L3 | Lenti ORF clone of Human sperm protein associated with the nucleus, X-linked, family member A1 (SPANXA1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC211653L4 | Lenti ORF clone of Human sperm protein associated with the nucleus, X-linked, family member A1 (SPANXA1), mGFP tagged |
CNY 5890.00 |
|
| RG211653 | SPANXA1 (tGFP-tagged) - Human sperm protein associated with the nucleus, X-linked, family member A1 (SPANXA1) |
CNY 2800.00 |
其它SPANXA1产品
