MTUS2 (NM_015233) Human Untagged Clone

CAT#: SC304267

MTUS2 (untagged)-Human microtubule associated tumor suppressor candidate 2 (MTUS2), transcript variant 2



  "NM_015233" in other vectors (4)

CNY 5610.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal CAZIP Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAZIP; ICIS; KIAA0774; TIP150
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304267 representing NM_015233.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCCATTGCTGCTGCAAGCCTTATAACTGCCTTCAGTGCCTGGACAAGACGAATGAAAGTGCCCTT
GTGAAAGAAAAAGAGCTGTCAATCGAACTTGCAAACATCAGGGATGAAGTTGCCTTCCATACAGCAAAG
TGCGAGAAACTACAAAAGGAGAAGGAGGAGCTGGAGAGGCGGTTCGAGGACGAGGTGAAGAGGCTGGGC
TGGCAGCAGCAGGCCGAGCTCCAGGAGCTGGAGGAGCGGCTGCAGCTGCAATTCGAGGCGGAAATGGCG
CGCCTGCAGGAGGAGCACGGTGACCAGCTGCTGAGCATCCGGTGTCAACACCAGGAGCAGGTGGAAGAT
CTCACCGCCAGCCATGATGCTGCTCTCCTAGAGATGGAAAATAACCACACAGTTGCCATCACAATCCTG
CAGGATGACCACGACCACAAAGTCCAAGAATTGATGTCCACTCATGAGCTTGAAAAGAAAGAATTGGAA
GAAAATTTTGAAAAACTGCGGCTGTCATTGCAGGACCAGGTGGACACGCTGACCTTCCAGAGCCAGTCT
CTGCGGGACAGAGCCCGCCGCTTCGAAGAGGCCTTGAGGAAGAACACAGAGGAGCAGCTGGAGATTGCA
TTGGCTCCTTATCAGCACTTGGAAGAAGACATGAAGAGTCTGAAGCAGGTATTAGAAATGAAGAATCAG
CAAATACACGAGCAAGAAAAGAAGATTCTTGAGCTGGAAAAGCTGGCAGAAAAGAACATTATCCTAGAA
GAAAAGATCCAGGTTCTCCAACAGCAGAACGAAGACCTCAAAGCAAGGATTGACCAAAACACAGTTGTC
ACCAGACAGCTGTCGGAGGAAAATGCTAACCTCCAGGAATATGTTGAGAAGGAAACCCAGGAGAAGAAG
AGATTGAGCCGAACCAATGAAGAGCTGCTTTGGAAGCTCCAAACTGGGGACCCGACCAGTCCGATTAAA
CTCTCGCCCACATCTCCCGTTTACCGCGGCTCCTCCTCGGGGCCCTCCTCTCCGGCCAGAGTCAGCACA
ACACCCAGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_015233
Insert Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_015233.5
RefSeq Size 4009 bp
RefSeq ORF 1047 bp
Locus ID 23281
UniProt ID Q5JR59
MW 40.7 kDa
Gene Summary Binds microtubules. Together with MAPRE1 may target the microtubule depolymerase KIF2C to the plus-end of microtubules. May regulate the dynamics of microtubules at their growing distal tip.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has multiple differences in the presence and absence of exons at its 5' end, compared to variant 1. These differences produce a unique 5' UTR and cause translation initiation at a unique start codon, compared to variant 1. The encoded protein (isoform b) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...