TAS2R4 (NM_016944) Human Untagged Clone
CAT#: SC304455
TAS2R4 (untagged)-Human taste receptor, type 2, member 4 (TAS2R4)
CNY 2400.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | T2R4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_016944 edited
TGCCTCCACTATCAGCACCACAACTGCTGAATCCTCAATGAGTAAAGATGCTTCGGTTAT TCTATTCCTCTGCTATTATTGCCTCAGTTATTTTAAATTTTGTAGGAATCATTATGAATC TGTTTATTACAGTGGTCAATTGCAAAACTTGGGTCAAAAGCCATAGAATCTCCTCTTCTG ATAGGATTCTGTTCAGCCTGGGCATCACCAGGTTTCTTATGCTGGGACTATTTCTGGTGA ACACCATCTACTTCGTCTCTTCAAATACGGAAAGGTCAGTCTACCTGTCTGCTTTTTTTG TGTTGTGTTTCATGTTTTTGGACTCGAGCAGTCTCTGGTTTGTGACCTTGCTCAATATCT TGTACTGTGTGAAGATTACTAACTTCCAACACTCAGTGTTTCTCCTGCTGAAGCGGAATA TCTCCCCAAAGATCCCCAGGCTGCTGCTGGCCTGTGTGCTGATTTCTGCTTTCACCACTT GCCTGTACATCACGCTTAGCCAGGCATCACCTTTTCCTGAACTTGTGACTACGAGAAATA ACACATCATTTAATATCAATGAGGGCATCTTGTCTTTAGTGGTTTCTTTGGTCTTGAGCT CATCTCTCCAGTTCATCATTAATGTGACTTCTGCTTCCTTGCTAATACACTCCTTGAGGA GACATATACAGAAGATGCAGAAAAATGCCACTGGTTTCTGGAATCCCCAGACGGAAGCTC ATGTAGGTGCTATGAAGCTGATGGTCTATTTCCTCATCCTCTACATTCCATATTCAGTTG CTACCCTGGTCCAGTATCTCCCCTTTTATGCAGGGATGGATATGGGGACCAAATCCATTT GTCTGATTTTTGCCACCCTTTACTCTCCAGGACATTCTGTTCTCATTATTATCACACATC CTAAACTGAAAACAACAGCAAAGAAGATTCTTTGTTTCAAAAAATAGTGGAATTTCAGTA AACAATACCTAGATTTACCTGATGGTTTGGGGGC |
Restriction Sites | Please inquire |
ACCN | NM_016944 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain 2 SNPs compared with NM_016944.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_016944.1, NP_058640.1 |
RefSeq Size | 900 bp |
RefSeq ORF | 900 bp |
Locus ID | 50832 |
UniProt ID | Q9NYW5 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Taste transduction |
Gene Summary | This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. These apparently intronless genes encode a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216710 | TAS2R4 (Myc-DDK-tagged)-Human taste receptor, type 2, member 4 (TAS2R4) |
CNY 2400.00 |
|
RC216710L3 | Lenti ORF clone of Human taste receptor, type 2, member 4 (TAS2R4), Myc-DDK-tagged |
CNY 5890.00 |
|
RC216710L4 | Lenti ORF clone of Human taste receptor, type 2, member 4 (TAS2R4), mGFP tagged |
CNY 5890.00 |
|
RG216710 | TAS2R4 (tGFP-tagged) - Human taste receptor, type 2, member 4 (TAS2R4) |
CNY 4370.00 |