CABP5 (NM_019855) Human Untagged Clone
CAT＃: SC304688
CABP5 (untagged)-Human calcium binding protein 5 (CABP5)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CABP3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC304688 representing NM_019855.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGTTCCCCATGGGCCCCGCCTGCATCTTCTTGAGGAAAGGCATTGCTGAGAAACAGCGGGAAAGA CCACTGGGACAAGATGAGATTGAAGAGCTGCGGGAAGCATTTCTTGAGTTCGATAAGGACCGAGATGGG TTCATCTCTTGTAAGGATCTGGGGAATCTCATGAGGACGATGGGTTACATGCCCACGGAGATGGAACTG ATTGAGCTCGGCCAGCAAATCCGCATGAACCTGGGTGGCCGTGTAGACTTTGATGACTTTGTGGAGCTG ATGACCCCCAAATTGCTTGCAGAAACAGCTGGGATGATCGGTGTCCAGGAGATGCGGGATGCCTTCAAG GAGTTTGACACGAATGGAGATGGGGAGATCACCCTGGTGGAGCTACAGCAGGCCATGCAGAGACTCCTG GGGGAGCGGCTCACCCCCCGGGAGATCTCTGAGGTTGTCCGGGAGGCTGATGTTAATGGAGACGGCACA GTTGACTTTGAAGAGTTTGTGAAGATGATGTCTCGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_019855 |
| Insert Size | 522 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019855.4 |
| RefSeq Size | 1845 bp |
| RefSeq ORF | 522 bp |
| Locus ID | 56344 |
| UniProt ID | Q9NP86 |
| MW | 19.8 kDa |
| Gene Summary | The product of this gene belongs to a subfamily of calcium binding proteins, which share similarity to calmodulin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Expression of this gene is retina-specific. The mouse homolog of this protein has been shown to express in the inner nuclear layer of the retina, suggested its role in neuronal functioning. The specific function of this gene is unknown. [provided by RefSeq, Oct 2009] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213946 | CABP5 (Myc-DDK-tagged)-Human calcium binding protein 5 (CABP5) |
CNY 2400.00 |
|
| RC213946L3 | Lenti ORF clone of Human calcium binding protein 5 (CABP5), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC213946L4 | Lenti ORF clone of Human calcium binding protein 5 (CABP5), mGFP tagged |
CNY 5890.00 |
|
| RG213946 | CABP5 (tGFP-tagged) - Human calcium binding protein 5 (CABP5) |
CNY 4000.00 |
