phospholipid scramblase 2 (PLSCR2) (NM_020359) Human Untagged Clone

CAT#: SC304747

PLSCR2 (untagged)-Human phospholipid scramblase 2 (PLSCR2)



  "NM_020359" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
PLSCR2 mouse monoclonal antibody,clone OTI7A5
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_020359 edited
CCAGGCTGGACACACTGGGAAACAGGCTGACCACCTGGGCTCCCAGGCCTTCTACCCAGG
ACGTCAGCATGACTACCTAGTCCCACCTGCTGGCACAGCTGGCATTCCTGTTCAAAATCA
GCCAGGTAGACCTGAAGGGGTACCATGGATGCCAGCACCACCACCACCATTAAACTGTCC
GCCAGGATTGGAATACTTAAGTCAGATAGATATGATACTAATTCATCAGCAAATTGAACT
TCTGGAAGTTCTATTCAGTTTTGAAAGTAGTAACATGTATGAAATCAAGAACAGCTTTGG
GCAGAGGATTTATTTTGCAGCAGAAGATACTAATTTCTGTATCCGAAATTGCTGTGGGCG
GTCTAGACCTTTTACCTTGAGGATTACTGATAATGTGGGTCGAGAAGTCATAACTCTGGA
AAGACCACTAAGATGTAACTGTTGTTGTTGCCCCTGCTGCCTTCAGGAGATAGAAATCCA
AGCTCCTCCTGGTGTACCAGTAGGTTATGTTACTCAGACCTGGCACCCATGTCTAACAAA
GTTTACAATTAAAAATCAGAAAAGAGAGGATGTACTAAAAATTAGTGGTCCATGTATCGT
GTGCAGCTGTATTGCGGGTGTTGATTTTGAGATTACATCTCTTGATGAACAAATTGTGGT
TGGCAGGATTTCTAAGCACTGGTCTGGGTTTTTAAGAGAGGCATTTACTGATGCTGACAA
CTTTGGAATCCAATTCCCTAGAGACCTTGATGTTAAAATGAAAGCCGTGATGATTGGTGC
CTGTTTCCTCATTGACTACATGTTTTTTGAAAGAACTAGGTAATGACTGGAATGTCAGAG
TGTGGGAGTGGATTAATGATTCCGGATCTTTGGCTAGGCAAAATGAAACTATAACTGATC
TAAACGGTTCCTTCCTTCTTCTACTGTGCAAGGAAGATGTAAGGAAAAACTCGCACACTA
TCTG
Restriction Sites Please inquire     
ACCN NM_020359
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM020359.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_020359.1, NP_065092.1
RefSeq Size 1265 bp
RefSeq ORF 675 bp
Locus ID 57047
UniProt ID Q9NRY7
Gene Summary This gene encodes a member of the phospholipid scramblase family. Phospholipid scramblases are membrane proteins that mediate calcium-dependent, non-specific movement of plasma membrane phospholipids and phosphatidylserine exposure. The encoded protein contains a low affinity calcium binding motif and may play a role in blood coagulation and apoptosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (3) differs in the 5' UTR, and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它phospholipid scramblase 2产品

Customer Reviews 
Loading...