FGF22 (NM_020637) Human Untagged Clone
CAT#: SC304788
FGF22 (untagged)-Human fibroblast growth factor 22 (FGF22)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_020637 edited
CGCCACCATGCGCCGCCGCCTGTGGCTGGGCCTGGCCTGGCTGCTGCTGGCGCGGGCGCC GGACGCCGCGGGAACCCCGAGCGCGTCGCGGGGACCGCGCAGCTACCCGCACCTGGAGGG CGACGTGCGCTGGCGGCGCCTCTTCTCCTCCACTCACTTCTTCCTGCGCGTGGATCCCGG CGGCCGCGTGCAGGGCACCCGCTGGCGCCACGGCCAGGACAGCATCCTGGAGATCCGCTC TGTACACGTGGGCGTCGTGGTCATCAAAGCAGTGTCCTCAGGCTTCTACGTGGCCATGAA CCGCCGGGGCCGCCTCTACGGGTCGCGACTCTACACCGTGGACTGCAGGTTCCGGGAGCG CATCGAAGAGAACGGCCACAACACCTACGCCTCACAGCGCTGGCGCCGCCGCGGCCAGCC CATGTTCCTGGCGCTGGACAGGAGGGGGGGGCCCCGGCCAGGCGGCCGGACGCGGCGGTA CCACCTGTCCGCCCACTTCCTGCCCGTCCTGGTCTCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_020637 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | It is not a varient. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020637.1, NP_065688.1 |
| RefSeq Size | 513 bp |
| RefSeq ORF | 513 bp |
| Locus ID | 27006 |
| UniProt ID | Q9HCT0 |
| Protein Families | Secreted Protein |
| Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
| Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The mouse homolog of this gene was found to be preferentially expressed in the inner root sheath of the hair follicle, which suggested a role in hair development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215757 | FGF22 (Myc-DDK-tagged)-Human fibroblast growth factor 22 (FGF22) |
CNY 2400.00 |
|
| RC215757L1 | Lenti ORF clone of Human fibroblast growth factor 22 (FGF22), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC215757L2 | Lenti ORF clone of Human fibroblast growth factor 22 (FGF22), mGFP tagged |
CNY 5890.00 |
|
| RC215757L3 | Lenti ORF clone of Human fibroblast growth factor 22 (FGF22), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC215757L4 | Lenti ORF clone of Human fibroblast growth factor 22 (FGF22), mGFP tagged |
CNY 5890.00 |
|
| RG215757 | FGF22 (tGFP-tagged) - Human fibroblast growth factor 22 (FGF22) |
CNY 4370.00 |
