MAVS (NM_020746) Human Untagged Clone
CAT#: SC304815
MAVS (untagged)-Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 6040.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CARDIF; IPS-1; IPS1; VISA |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_020746 edited
ATGCCGTTTGCTGAAGACAAGACCTATAAGTATATCTGCCGCAATTTCAGCAATTTTTGC AATGTGGATGTTGTAGAGATTCTGCCTTACCTGCCCTGCCTCACAGCAAGAGACCAGGAT CGACTGCGGGCCACCTGCACACTCTCAGGGAACCGGGACACCCTCTGGCATCTCTTCAAT ACCCTTCAGCGGCGGCCCGGCTGGGTGGAGTACTTCATTGCGGCACTGAGGGGCTGTGAG CTAGTTGATCTCGCGGACGAAGTGGCCTCTGTCTACCAGAGCTACCAGCCTCGGACCTCG GACCGTCCCCCAGACCCACTGGAGCCACCGTCACTTCCTGCTGAGAGGCCAGGGCCCCCC ACACCTGCTGCGGCCCACAGCATCCCCTACAACAGCTGCAGAGAGAAGGAGCCAAGTTAC CCCATGCCTGTCCAGGAGACCCAGGCGCCAGAGTCCCCAGGAGAGAATTCAGAGCAAGCC CTGCAGACGCTCAGCCCCAGAGCCATCCCAAGGAATCCAGATGGTGGCCCCCTGGAGTCC TCCTCTGACCTGGCAGCCCTCAGCCCTCTGACCTCCAGCGGGCATCAGGAGCAGGACACA GAACTGGGCAGTACCCACACAGCAGGTGCGACCTCCAGCCTCACACCATCCCGTGGGCCT GTGTCTCCATCTGTCTCCTTCCAGCCCCTGGCCCGTTCCACCCCCAGGGCAAGCCGCTTG CCTGGACCCACAGGGTCAGTTGTATCTACTGGCACCTCCTTCTCCTCCTCATCCCCTGGC TTGGCCTCTGCAGGGGCTGCAGAGGGTAAACAGGGTGCAGAGAGTGACCAGGCCGAGCCT ATCATCTGCTCCAGTGGGGCAGAGGCACCTGCCAACTCTCTGCCCTCCAAAGTGCCTACC ACCTTGATGCCTGTGAACACAGTGGCCCTGAAAGTGCCTGCCAACCCAGCATCTGTCAGC ACAGTGCCCTCCAAGTTGCCAACTAGCTCAAAGCCCCCTGGTGCAGTGCCTTCTAATGCG CTCACCAATCCAGCACCATCCAAATTGCCCATCAACTCAACCCGTGCTGGCATGGTGCCA TCCAAAGTGCCTACTAGCATGGTGCTCACCAAGGTGTCTGCCAGCACAGTCCCCACTGAC GGGAGCAGCAGAAATGAGGAGACCCCAGCAGCTCCAACACCCGCCGGCGCCACTGGAGGC AGCTCAGCCTGGCTAGACAGCAGCTCTGAGAATAGGGGCCTTGGGTCGGAGCTGAGTAAG CCTGGCGTGCTGGCATCCCAGGTAGACAGCCCGTTCTCGGGCTGCTTCGAGGATCTTGCC ATCAGTGCCAGCACCTCCTTGGGCATGGGGCCCTGCCATGGCCCAGAGGAGAATGAGTAT AAGTCCGAGGGCACCTTTGGGATCCACGTGGCTGAGAACCCCAGCATCCAGCTCCTGGAG GGCAACCCTGGGCCACCTGCGGACCCGGATGGCGGCCCCAGGCCACAAGCCGACCGGAAG TTCCAGGAGAGGGAGGTGCCATGCCACAGGCCCTCACCTGGGGCTCTGTGGCTCCAGGTG GCTGTGACAGGGGTGCTGGTAGTCACACTCCTGGTGGTGCTGTACCGGCGGCGTCTGCAC TAG |
| Restriction Sites | Please inquire |
| ACCN | NM_020746 |
| Insert Size | 4100 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020746.2, NP_065797.2 |
| RefSeq Size | 2936 bp |
| RefSeq ORF | 1623 bp |
| Locus ID | 57506 |
| UniProt ID | Q7Z434 |
| Protein Families | Transmembrane |
| Protein Pathways | Cytosolic DNA-sensing pathway, RIG-I-like receptor signaling pathway |
| Gene Summary | This gene encodes an intermediary protein necessary in the virus-triggered beta interferon signaling pathways. It is required for activation of transcription factors which regulate expression of beta interferon and contributes to antiviral innate immunity. [provided by RefSeq, Jul 2020] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208175 | MAVS (Myc-DDK-tagged)-Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 6032.00 |
|
| RC208175L1 | Lenti ORF clone of Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 8432.00 |
|
| RC208175L2 | Lenti ORF clone of Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 6460.00 |
|
| RC208175L3 | Lenti ORF clone of Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 8432.00 |
|
| RC208175L4 | Lenti ORF clone of Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 8432.00 |
|
| RG208175 | MAVS (tGFP-tagged) - Human mitochondrial antiviral signaling protein (MAVS), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 7632.00 |

