B3GALT1 (NM_020981) Human Untagged Clone

CAT#: SC304882

B3GALT1 (untagged)-Human UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 (B3GALT1)



  "NM_020981" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-B3GALT1 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms beta3Gal-T1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304882 representing NM_020981.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTTCAAAGGTCTCCTGTTTGTATGTTTTGACAGTTGTGTGCTGGGCCAGCGCTCTCTGGTACTTG
AGTATAACTCGCCCTACTTCTTCTTACACTGGCTCCAAACCATTCAGCCACCTAACAGTTGCCAGGAAA
AACTTCACCTTTGGCAACATAAGAACTCGACCTATCAACCCACATTCTTTTGAATTTCTTATCAACGAG
CCCAATAAATGTGAGAAAAACATTCCTTTTCTTGTTATCCTCATCAGCACCACTCACAAGGAATTTGAT
GCCCGTCAGGCAATCAGAGAGACGTGGGGGGATGAGAACAACTTTAAGGGGATCAAGATAGCCACCCTG
TTCCTCCTGGGCAAGAATGCTGATCCTGTTCTCAATCAGATGGTGGAGCAAGAGAGCCAAATCTTCCAT
GATATCATCGTGGAGGACTTTATTGACTCCTACCATAACCTTACCCTCAAAACATTAATGGGGATGAGA
TGGGTGGCCACTTTTTGTTCAAAAGCCAAGTATGTCATGAAAACAGACAGCGACATTTTTGTAAACATG
GACAATCTTATTTATAAATTACTGAAACCCTCCACCAAGCCACGAAGAAGGTATTTTACTGGCTATGTC
ATTAATGGAGGACCGATTCGGGATGTCCGCAGTAAGTGGTATATGCCCAGGGATTTGTACCCAGACAGT
AACTACCCACCTTTCTGTTCGGGGACTGGCTACATCTTTTCAGCCGATGTAGCTGAACTCATTTACAAG
ACCTCACTCCACACAAGGCTGCTTCACCTTGAAGACGTATATGTGGGACTGTGTCTTCGAAAGCTGGGC
ATACATCCTTTCCAGAACAGTGGCTTCAATCACTGGAAAATGGCCTACAGTTTGTGTAGGTATCGCCGA
GTTATCACTGTGCATCAGATCTCTCCAGAAGAAATGCACAGAATCTGGAATGACATGTCAAGCAAGAAA
CATCTCAGATGTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_020981
Insert Size 981 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020981.3
RefSeq Size 2168 bp
RefSeq ORF 981 bp
Locus ID 8708
UniProt ID Q9Y5Z6
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
MW 38 kDa
Gene Summary This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is expressed exclusively in the brain. The encoded protein shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...