SSX3 (NM_021014) Human Untagged Clone
CAT#: SC304892
SSX3 (untagged)-Human synovial sarcoma, X breakpoint 3 (SSX3), transcript variant 1
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT5.3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_021014 edited
CTCTCTCTTTCGATTCTTCCATACTCAAGAGTACGCACGGTCTGATTTTCTCTTTGGATT CTTCCAAAATCAGAGTCAGACTACTCCCTGTGCCATGAACGGAGATGACACCTTTGCAAG GAGACCCACGGTTGGTGCTCAAATACCAGAGAAGATACAAAAGGCCTTCGATGATATTGC CAAATACTTCTCTAAGGAAGAGTGGGAAAAGATGAAAGTCTCGGAGAAAATCGTCTATGT GTATATGAAGAGAAAGTATGAGGCCATGACTAAACTAGGTTTCAAGGCCATCCTCCCATC TTTCATGCGTAATAAACGGGTCACAGACTTCCAGGGGAATGATTTTGATAATGACCCTAA CCGTGGGAATCAGGTTCAACGTCCTCAGATGACTTTCGGCAGGCTCCAGGGAATCTTCCC GAAGATCATGCCCAAGAAGCCAGCAGAGGAAGGAAATGTTTCGAAGGAAGTGCCAGAAGC ATCTGGCCCACAAAACGATGGGAAACAGCTGTGCCCCCCGGGAAAACCAACTACCTCTGA GAAGATTAACATGATATCTGGACCCAAAAGGGGGGAACATGCCTGGACCCACAGACTGCG TGAGAGAAAGCAGCTGGTGATTTATGAAGAGATCAGCGATCCTGAGGAAGATGATGAGTA AGCGGCCGCGGTCATAGCTGTTTCC |
Restriction Sites | Please inquire |
ACCN | NM_021014 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021014.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021014.2, NP_066294.1 |
RefSeq Size | 1290 bp |
RefSeq ORF | 567 bp |
Locus ID | 10214 |
UniProt ID | Q99909 |
Protein Families | Transcription Factors |
Gene Summary | The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneous humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. While some of the related SSX genes are involved in t(X;18)(p11.2;q11.2) translocations that are characteristically found in all synovial sarcomas, this gene does not appear to be involved in such translocations. [provided by RefSeq, Jul 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224933 | SSX3 (Myc-DDK-tagged)-Human synovial sarcoma, X breakpoint 3 (SSX3), transcript variant 1 |
CNY 2400.00 |
|
RC224933L3 | Lenti ORF clone of Human synovial sarcoma, X breakpoint 3 (SSX3), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC224933L4 | Lenti ORF clone of Human synovial sarcoma, X breakpoint 3 (SSX3), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG224933 | SSX3 (tGFP-tagged) - Human synovial sarcoma, X breakpoint 3 (SSX3), transcript variant 1 |
CNY 4370.00 |