HOXD11 (NM_021192) Human Untagged Clone
CAT＃: SC304919
HOXD11 (untagged)-Human homeobox D11 (HOXD11)
CNY 5488.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HOX4; HOX4F |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_021192 edited
ATGAACGACTTTGACGAGTGCGGCCAGAGCGCAGCCAGCATGTACCTGCCGGGCTGCGCC TACTATGTGGCCCCGTCTGACTTCGCTAGCAAGCCTTCGTTCCTTTCCCAACCGTCGTCC TGCCAGATGACTTTCCCCTACTCTTCCAACCTGGCTCCGCACGTCCAGCCCGTGCGCGAA GTGGCCTTCCGCGACTACGGCCTGGAGCGCGCCAAGTGGCCGTACCGCGGCGGCGGCGGC GGCGGCAGCGCGGGGGGCGGCAGCAGCGGGGGCGGCCCCGGCGGGGGCGGCGGCGGCGCG GGGGGCTACGCTCCCTACTACGCGGCGGCGGCGGCGGCGGCTGCGGCGGCCGCGGCGGCC GAGGAGGCGGCCATGCAACGCGAGCTTCTCCCGCCCGCGGGCCGCCGGCCGGACGTGCTC TTCAAGGCGCCTGAGCCGGTGTGCGCTGCGCCGGGGCCGCCGCACGGCCCCGCGGGCGCC GCCTCCAACTTCTACAGCGCGGTGGGCCGCAATGGCATCTTGCCACAGGGCTTCGACCAG TTCTACGAGGCAGCGCCCGGGCCCCCGTTCGCCGGGCCGCAGCCCCCGCCGCCACCCGCG CCGCCACAGCCCGAGGGCGCAGCCGACAAGGGCGACCCCAGGACCGGGGCTGGTGGCGGC GGGGGCAGTCCCTGCACCAAGGCGACCCCTGGCTCGGAGCCCAAGGGGGCAGCAGAAGGC AGCGGTGGCGACGGCGAGGGCCCCCCGGGAGAGGCGGGGGCCGAGAAGAGCAGCAGCGCA GTTGCCCCCCAGCGGTCCCGGAAAAAGCGCTGTCCCTATACCAAGTACCAGATCCGCGAA CTGGAACGCGAGTTTTTCTTTAACGTGTACATAAACAAAGAGAAAAGACTTCAACTCTCT CGGATGCTCAACCTCACTGACCGGCAAGTCAAAATCTGGTTCCAGAATCGCAGGATGAAA GAAAAGAAACTGAACAGAGACCGTCTGCAGTATTTCACTGGAAACCCCTTATTTTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_021192 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021192.2, NP_067015.2 |
| RefSeq Size | 1463 bp |
| RefSeq ORF | 1017 bp |
| Locus ID | 3237 |
| UniProt ID | P31277 |
| Gene Summary | This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The product of the mouse Hoxd11 gene plays a role in forelimb morphogenesis. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214985 | HOXD11 (Myc-DDK-tagged)-Human homeobox D11 (HOXD11) |
CNY 5488.00 |
|
| RC214985L1 | Lenti ORF clone of Human homeobox D11 (HOXD11), Myc-DDK-tagged |
CNY 7888.00 |
|
| RC214985L2 | Lenti ORF clone of Human homeobox D11 (HOXD11), mGFP tagged |
CNY 5890.00 |
|
| RC214985L3 | Lenti ORF clone of Human homeobox D11 (HOXD11), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC214985L4 | Lenti ORF clone of Human homeobox D11 (HOXD11), mGFP tagged |
CNY 5890.00 |
|
| RG214985 | HOXD11 (tGFP-tagged) - Human homeobox D11 (HOXD11) |
CNY 4370.00 |
