H4C11 (NM_021968) Human Untagged Clone
CAT#: SC304978
HIST1H4J (untagged)-Human histone cluster 1, H4j (HIST1H4J)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | dJ160A22.2; H4-16; H4/e; H4C1; H4C2; H4C3; H4C4; H4C5; H4C6; H4C8; H4C9; H4C12; H4C13; H4C14; H4C15; H4F2iv; H4FE; HIST1H4J |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC304978 representing NM_021968.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTGGCCGCGGCAAAGGCGGGAAGGGTCTTGGCAAAGGCGGCGCTAAGCGCCACCGTAAAGTACTG CGCGACAATATCCAGGGCATCACCAAGCCGGCCATCCGGCGCCTTGCTCGCCGCGGCGGCGTGAAGCGC ATCTCCGGCCTCATCTACGAGGAGACTCGCGGGGTGCTGAAGGTGTTCCTGGAGAACGTGATCCGGGAC GCCGTGACCTATACAGAGCACGCCAAGCGCAAGACGGTCACCGCCATGGATGTGGTCTACGCGCTCAAG CGCCAGGGCCGCACCCTCTACGGTTTCGGTGGTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_021968 |
Insert Size | 312 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021968.3 |
RefSeq Size | 356 bp |
RefSeq ORF | 312 bp |
Locus ID | 8363 |
UniProt ID | P62805 |
Protein Pathways | Systemic lupus erythematosus |
MW | 11.4 kDa |
Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205736 | HIST1H4J (Myc-DDK-tagged)-Human histone cluster 1, H4j (HIST1H4J) |
CNY 1200.00 |
|
RC205736L3 | Lenti ORF clone of Human histone cluster 1, H4j (HIST1H4J), Myc-DDK-tagged |
CNY 5890.00 |
|
RC205736L4 | Lenti ORF clone of Human histone cluster 1, H4j (HIST1H4J), mGFP tagged |
CNY 5890.00 |
|
RG205736 | HIST1H4J (tGFP-tagged) - Human histone cluster 1, H4j (HIST1H4J) |
CNY 2800.00 |
|
SC320947 | HIST1H4J (untagged)-Human histone cluster 1, H4j (HIST1H4J) |
CNY 1200.00 |