Urotensin II (UTS2) (NM_021995) Human Untagged Clone

CAT#: SC304981

UTS2 (untagged)-Human urotensin 2 (UTS2), transcript variant 1



  "NM_021995" in other vectors (4)

CNY 1800.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-UTS2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PRO1068; U-II; UCN2; UII
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_021995 edited
GGGATGGCAGCCCTAAACACAGCATGGCAACTCATCTACTCACTCATGAAAGATTAAAAA
ATGGAAACCAACGTATTTCATCTTATGCTCTGCGTCACTTCTGCTCGGACTCATAAATCC
ACGTCTCTTTGCTTTGGCCACTTCAACTCATATCCAAGCCTTCCTTTAATTCATGATTTA
TTGCTGGAAATATCCTTTCAACTCTCAGCACCTCATGAAGACGCGCGCTTAACTCCGGAG
GAGCTAGAAAGAGCTTCCCTTCTACAGATACTGCCAGAGATGCTGGGTGCAGAAAGAGGG
GATATTCTCAGGAAAGCAGACTCAAGTACCAACATTTTTAACCCAAGAGGAAATTTGAGA
AAGTTTCAGGATTTCTCTGGACAAGATCCTAACATTTTACTGAGTCATCTTTTGGCCAGA
ATCTGGAAACCATACAAGAAACGTGAGACTCCTGATTGCTTCTGGAAATACTGTGTCTGA
AGTGAAATAAGCATCTGTTAGTCAGCTCAGAAACACCCATCTTAGAATATGAAAAATAAC
ACAATGCTTGATTTGAAAACAGTGTGGAGAAAAACTAGGCAAACTACACCCTGTTCATTG
TTACCTGGA
Restriction Sites Please inquire     
ACCN NM_021995
Insert Size 600 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021995.1, NP_068835.1
RefSeq Size 652 bp
RefSeq ORF 420 bp
Locus ID 10911
UniProt ID O95399
Protein Families Secreted Protein
Gene Summary This gene encodes a mature peptide that is an active cyclic heptapeptide absolutely conserved from lamprey to human. The active peptide acts as a vasoconstrictor and is expressed only in brain tissue. Despite the gene family name similarity, this gene is not homologous to urocortin, a member of the sauvagine/corticotropin-releasing factor/urotensin I family. Most of the proprotein is cleaved to make the mature peptide. Transcript variants encoding different preproprotein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes a longer preproprotein isoform (a) of 139 amino acids with a different amino-terminal end compared to isoform b. The mature peptide is identical for both transcript variants.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...