Livin (BIRC7) (NM_022161) Human Untagged Clone
CAT#: SC305009
BIRC7 (untagged)-Human baculoviral IAP repeat containing 7 (BIRC7), transcript variant 2
CNY 6270.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | KIAP; LIVIN; ML-IAP; MLIAP; RNF50 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_022161, the custom clone sequence may differ by one or more nucleotides
ATGGGACCTAAAGACAGTGCCAAGTGCCTGCACCGTGGACCACAGCCGAGCCACTGGGCAGCCGGTGATG GTCCCACGCAGGAGCGCTGTGGACCCCGCTCTCTGGGCAGCCCTGTCCTAGGCCTGGACACCTGCAGAGC CTGGGACCACGTGGATGGGCAGATCCTGGGCCAGCTGCGGCCCCTGACAGAGGAGGAAGAGGAGGAGGGC GCCGGGGCCACCTTGTCCAGGGGGCCTGCCTTCCCCGGCATGGGCTCTGAGGAGTTGCGTCTGGCCTCCT TCTATGACTGGCCGCTGACTGCTGAGGTGCCACCCGAGCTGCTGGCTGCTGCCGGCTTCTTCCACACAGG CCATCAGGACAAGGTGAGGTGCTTCTTCTGCTATGGGGGCCTGCAGAGCTGGAAGCGCGGGGACGACCCC TGGACGGAGCATGCCAAGTGGTTCCCCAGCTGTCAGTTCCTGCTCCGGTCAAAAGGAAGAGACTTTGTCC ACAGTGTGCAGGAGACTCACTCCCAGCTGCTGGGCTCCTGGGACCCGTGGGAAGAACCGGAAGACGCAGC CCCTGTGGCCCCCTCCGTCCCTGCCTCTGGGTACCCTGAGCTGCCCACACCCAGGAGAGAGGTCCAGTCT GAAAGTGCCCAGGAGCCAGGAGCCAGGGATGTGGAGGCGCAGCTGCGGCGGCTGCAGGAGGAGAGGACGT GCAAGGTGTGCCTGGACCGCGCCGTGTCCATCGTCTTTGTGCCGTGCGGCCACCTGGTCTGTGCTGAGTG TGCCCCCGGCCTGCAGCTGTGCCCCATCTGCAGAGCCCCCGTCCGCAGCCGCGTGCGCACCTTCCTGTCC TAG |
| Restriction Sites | Please inquire |
| ACCN | NM_022161 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_022161.2, NP_071444.1 |
| RefSeq Size | 1268 bp |
| RefSeq ORF | 843 bp |
| Locus ID | 79444 |
| UniProt ID | Q96CA5 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a member of the inhibitor of apoptosis protein (IAP) family, and contains a single copy of a baculovirus IAP repeat (BIR) as well as a RING-type zinc finger domain. The BIR domain is essential for inhibitory activity and interacts with caspases, while the RING finger domain sometimes enhances antiapoptotic activity but does not inhibit apoptosis alone. Elevated levels of the encoded protein may be associated with cancer progression and play a role in chemotherapy sensitivity. Alternative splicing results in multiple transcript variants [provided by RefSeq, Jul 2013] Transcript Variant: This variant (2) uses an alternate in-frame splice site, compared to variant 1. The encoded isoform (beta) is shorter, compared to isoform alpha. Isoform beta protects cells from etoposide-induced apoptosis. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215363 | BIRC7 (Myc-DDK-tagged)-Human baculoviral IAP repeat containing 7 (BIRC7), transcript variant 2 |
CNY 3600.00 |
|
| RC215363L1 | Lenti ORF clone of Human baculoviral IAP repeat containing 7 (BIRC7), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC215363L2 | Lenti ORF clone of Human baculoviral IAP repeat containing 7 (BIRC7), transcript variant 2, mGFP tagged |
CNY 6000.00 |
|
| RC215363L3 | Lenti ORF clone of Human baculoviral IAP repeat containing 7 (BIRC7), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC215363L4 | Lenti ORF clone of Human baculoviral IAP repeat containing 7 (BIRC7), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG215363 | BIRC7 (tGFP-tagged) - Human baculoviral IAP repeat containing 7 (BIRC7), transcript variant 2 |
CNY 5200.00 |
