KCNA7 (NM_031886) Human Untagged Clone
CAT#: SC305352
KCNA7 (untagged)-Human potassium voltage-gated channel, shaker-related subfamily, member 7 (KCNA7)
CNY 3656.00
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HAK6; KV1.7 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_031886 edited
ATGGAGCCGCGGTGCCCGCCGCCGTGCGGCTGCTGCGAGCGGCTGGTGCTCAACGTGGCC GGGCTGCGCTTCGAGACGCGGGCGCGCACGCTGGGCCGCTTCCCGGACACTCTGCTAGGG GACCCAGCGCGCCGCGGCCGCTTCTACGACGACGCGCGCCGCGAGTATTTCTTCGACCGG CACCGGCCCAGCTTCGACGCCGTGCTCTACTACTACCAGTCCGGTGGGCGGCTGCGGCGG CCGGCGCACGTGCCGCTCGACGTCTTCCTGGAAGAGGTGGCCTTCTACGGGCTGGGCGCG GCGGCCCTGGCACGCCTGCGCGAGGACGAGGGCTGCCCGGTGCCGCCCGAGCGCCCCCTG CCCCGCCGCGCCTTCGCCCGCCAGCTGTGGCTGCTTTTCGAGTTTCCCGAGAGCTCTCAG GCCGCGCGCGTGCTCGCCGTAGTCTCCGTGCTGGTCATCCTCGTCTCCATCGTCGTCTTC TGCCTCGAGACGCTGCCTGACTTCCGCGACGACCGCGACGGCACGGGGCTTGCTGCTGCA GCCGCAGCCGGCCCGTTCCCCGCTCCGCTGAATGGCTCCAGCCAAATGCCTGGAAATCCA CCCCGCCTGCCCTTCAATGACCCGTTCTTCGTGGTGGAGACGCTGTGTATTTGTTGGTTC TCCTTTGAGCTGCTGGTACGCCTCCTGGTCTGTCCAAGCAAGGCTATCTTCTTCAAGAAC GTGATGAACCTCATCGATTTTGTGGCTATCCTTCCCTACTTTGTGGCACTGGGCACCGAG CTGGCCCGGCAGCGAGGGGTGGGCCAGCAGGCCATGTCACTGGCCATCCTGAGAGTCATC CGATTGGTGCGTGTCTTCCGCATCTTCAAGCTGTCCCGGCACTCAAAGGGCCTGCAAATC TTGGGCCAGACGCTTCGGGCCTCCATGCGTGAGCTGGGCCTCCTCATCTTTTTCCTCTTC ATCGGTGTGGTCCTCTTTTCCAGCGCCGTCTACTTTGCCGAAGTTGACCGGGTGGACTCC CATTTCACTAGCATCCCTGAGTCCTTCTGGTGGGCGGTAGTCACCATGACTACAGTTGGC TATGGAGACATGGCACCCGTCACTGTGGGTGGCAAGATAGTGGGCTCTCTGTGTGCCATT GCGGGCGTGCTGACTATTTCCCTGCCAGTGCCCGTCATTGTCTCCAATTTCAGCTACTTT TATCACCGGGAGACAGAGGGCGAAGAGGCTGGGATGTTCAGCCATGTGGACATGCAGCCT TGTGGCCCACTGGAGGGCAAGGCCAATGGGGGGCTGGTGGACGGGGAGGTACCTGAGCTA CCACCTCCACTCTGGGCACCCCCAGGGAAACACCTGGTCACCGAAGTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_031886 |
| Insert Size | 1400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_031886.2, NP_114092.2 |
| RefSeq Size | 4372 bp |
| RefSeq ORF | 1371 bp |
| Locus ID | 3743 |
| UniProt ID | Q96RP8 |
| Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
| Gene Summary | Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. The gene is expressed preferentially in skeletal muscle, heart and kidney. It is a candidate gene for inherited cardiac disorders. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222164 | KCNA7 (Myc-DDK-tagged)-Human potassium voltage-gated channel, shaker-related subfamily, member 7 (KCNA7) |
CNY 3656.00 |
|
| RC222164L1 | Lenti ORF clone of Human potassium voltage-gated channel, shaker-related subfamily, member 7 (KCNA7), Myc-DDK-tagged |
CNY 6056.00 |
|
| RC222164L2 | Lenti ORF clone of Human potassium voltage-gated channel, shaker-related subfamily, member 7 (KCNA7), mGFP tagged |
CNY 5890.00 |
|
| RC222164L3 | Lenti ORF clone of Human potassium voltage-gated channel, shaker-related subfamily, member 7 (KCNA7), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC222164L4 | Lenti ORF clone of Human potassium voltage-gated channel, shaker-related subfamily, member 7 (KCNA7), mGFP tagged |
CNY 5890.00 |
|
| RG222164 | KCNA7 (tGFP-tagged) - Human potassium voltage-gated channel, shaker-related subfamily, member 7 (KCNA7) |
CNY 5256.00 |
