WNT8A (NM_031933) Human Untagged Clone

CAT#: SC305368

WNT8A (untagged)-Human wingless-type MMTV integration site family, member 8A (WNT8A), transcript variant 1



CNY 3656.00

CNY 6270.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-WNT8A Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OTTHUMP00000180556; wingless-type MMTV integration site family, member 8A; WNT8D
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_031933 edited
GGTACCGATCGCCATGGGGAACCTGTTTATGCTCTGGGCAGCTCTGGGCATATGCTGTGC
TGCATTCAGTGCCTCTGCCTGGTCAGTGAACAATTTCCTGATAACAGGTCCCAAGGCCTA
TCTGACCTACACGACTAGTGTGGCCTTGGGTGCCCAGAGTGGCATCGAGGAGTGCAAGTT
CCAGTTTGCTTGGGAACGCTGGAACTGCCCTGAAAATGCTCTTCAGCTCTCCACCCACAA
CAGGCTGAGAAGTGCTACCAGAGAGACTTCCTTCATACATGCTATCAGCTCTGCTGGAGT
CATGTACATCATCACCAAGAACTGTAGCATGGGTGACTTCGAAAACTGTGGCTGTGATGG
GTCAAACAATGGAAAAACAGGAGGCCATGGCTGGATCTGGGGAGGCTGCAGCGACAATGT
GGAATTTGGGGAAAGGATCTCCAAACTCTTTGTGGACAGTTTGGAGAAGGGGAAGGATGC
CAGAGCCCTGATGAATCTTCACAACAACAGGGCCGGCAGACTGGCAGTGAGAGCCACCAT
GAAAAGGACATGCAAATGTCATGGCATCTCTGGGAGCTGCAGCATACAGACATGCTGGCT
GCAGCTGGCTGAATTCCGGGAGATGGGAGACTACCTAAAGGCCAAGTATGACCAGGCGCT
GAAAATTGAAATGGATAAGCGGCAGCTGAGAGCTGGGAACAGCGCCGAGGGCCACTGGGT
GCCCGCTGAGGCCTTCCTTCCTAGCGCAGAGGCGGAACTGATCTTTTTAGAGGAATCACC
AGATTACTGTACCTGCAATTCCAGCCTGGGCATCTATGGCACAGAGGGTCGTGAGTGCCT
ACAGAACAGCCACAACACATCCAGGTGGGAGCGACGTAGCTGTGGGCGCCTGTGCACTGA
GTGTGGGCTGCAGGTGGAAGAGAGGAAAACTGAGGTCATAAGCAGCTGTAACTGCAAATT
CCAGTGGTGCTGTACGGTCAAGTGTGACCAGTGTAGGCATGTGGTGAGCAAGTATTACTG
CGCACGCTCCCCAGGCAGTGCCCAGTCCCTGGGGAGAGTTTGGTTTGGGGTCTATATCTA
GCTCGAGCAGAAACTCATCTCAGAAGAGTCTAGA
Restriction Sites Please inquire     
ACCN NM_031933
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_031933.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_031933.1, NP_114139.1
RefSeq Size 1597 bp
RefSeq ORF 1068 bp
Locus ID 7478
Protein Families Cancer stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Stem cell relevant signaling - Wnt Signaling pathway
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
Gene Summary The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and may be implicated in development of early embryos as well as germ cell tumors. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) lacks an internal fragment and encodes a longer isoform with distinct C-terminus, as compared to variant 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...