Caspase-6 (CASP6) (NM_032992) Human Untagged Clone
CAT#: SC305528
CASP6 (untagged)-Human caspase 6, apoptosis-related cysteine peptidase (CASP6), transcript variant beta
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MCH2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305528 representing NM_032992.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCTCGGCCTCGGGGCTCCGCAGGGGGCACCCGGCAGTGTCAACTGTTAGCCACGCAGATGCCGAT TGCTTTGTGTGTGTCTTCCTGAGCCATGGCGAAGGCAATCACATTTATGCATATGATGCTAAAATCGAA ATTCAGACATTAACTGGCTTGTTCAAAGGAGACAAGTGTCACAGCCTGGTTGGAAAACCCAAGATATTT ATCATTCAGGCATGTCGGGGAAACCAGCACGATGTGCCAGTCATTCCTTTGGATGTAGTAGATAATCAG ACAGAGAAGTTGGACACCAACATAACTGAGGTGGATGCAGCCTCCGTTTACACGCTGCCTGCTGGAGCT GACTTCCTCATGTGTTACTCTGTTGCAGAAGGATATTATTCTCACCGGGAAACTGTGAACGGCTCATGG TACATTCAAGATTTGTGTGAGATGTTGGGAAAATATGGCTCCTCCTTAGAGTTCACAGAACTCCTCACA CTGGTGAACAGGAAAGTTTCTCAGCGCCGAGTGGACTTTTGCAAAGACCCAAGTGCAATTGGAAAGAAG CAGGTTCCCTGTTTTGCCTCAATGCTAACTAAAAAGCTGCATTTCTTTCCAAAATCTAATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_032992 |
Insert Size | 615 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_032992.2 |
RefSeq Size | 1394 bp |
RefSeq ORF | 615 bp |
Locus ID | 839 |
UniProt ID | P55212 |
Protein Families | Druggable Genome, Protease, Stem cell - Pluripotency |
Protein Pathways | Apoptosis |
MW | 22.6 kDa |
Gene Summary | This gene encodes a member of the cysteine-aspartic acid protease (caspase) family of enzymes. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic acid residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein is processed by caspases 7, 8 and 10, and is thought to function as a downstream enzyme in the caspase activation cascade. Alternative splicing of this gene results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (beta) lacks several exons in the coding region but maintains the reading frame, compared to variant alpha. It encodes isoform beta which is shorter than isoform alpha. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221381 | CASP6 (Myc-DDK-tagged)-Human caspase 6, apoptosis-related cysteine peptidase (CASP6), transcript variant beta |
CNY 2400.00 |
|
RC221381L1 | Lenti ORF clone of Human caspase 6, apoptosis-related cysteine peptidase (CASP6), transcript variant beta, Myc-DDK-tagged |
CNY 4800.00 |
|
RC221381L2 | Lenti ORF clone of Human caspase 6, apoptosis-related cysteine peptidase (CASP6), transcript variant beta, mGFP tagged |
CNY 5890.00 |
|
RC221381L3 | Lenti ORF clone of Human caspase 6, apoptosis-related cysteine peptidase (CASP6), transcript variant beta, Myc-DDK-tagged |
CNY 5890.00 |
|
RC221381L4 | Lenti ORF clone of Human caspase 6, apoptosis-related cysteine peptidase (CASP6), transcript variant beta, mGFP tagged |
CNY 5890.00 |
|
RG221381 | CASP6 (tGFP-tagged) - Human caspase 6, apoptosis-related cysteine peptidase (CASP6), transcript variant beta |
CNY 4370.00 |
其它Caspase-6产品