FGF8 (NM_033163) Human Untagged Clone

CAT#: SC305580

FGF8 (untagged)-Human fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant F



  "NM_033163" in other vectors (6)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


FGF8 Antibody - C-terminal region
    • 50 ug

CNY 4628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIGF; FGF-8; HBGF-8; HH6; KAL6
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_033163 edited
CGGAGCCGCGCGCCATGGGCAGCCCCCGCTCCGCGCTGAGCTGCCTGCTGTTGCACTTGC
TGGTCCTCTGCCTCCAAGCCCAGGAAGGCCCGGGCAGGGGCCCTGCGCTGGGCAGGGAGC
TCGCTTCCCTGTTCCGGGCTGGCCGGGAGCCCCAGGGTGTCTCCCAACAGGTAACTGTTC
AGTCCTCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACGGATCAGCTCA
GCCGCCGCCTCATCCGGACCTACCAACTCTACAGCCGCACCAGCGGGAAGCACGTGCAGG
TCCTGGCCAACAAGCGCATCAACGCCATGGCAGAGGACGGCGACCCCTTCGCAAAGCTCA
TCGTGGAGACGGACACCTTTGGAAGCAGAGTTCGAGTCCGAGGAGCCGAGACGGGCCTCT
ACATCTGCATGAACAAGAAGGGGAAGCTGATCGCCAAGAGCAACGGCAAAGGCAAGGACT
GCGTCTTCACGGAGATTGTGCTGGAGAACAACTACACAGCGCTGCAGAATGCCAAGTACG
AGGGCTGGTACATGGCCTTCACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGACGCGGC
AGCACCAGCGTGAGGTCCACTTCATGAAGCGGCTGCCCCGGGGCCACCACACCACCGAGC
AGAGCCTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGCC
AGAGGACTTGGGCCCCCGAGCCCCGATAGGTGCTGCCTGGCCCTCCCCACAATGCCAGAC
CGCAGAGAGGCTCATCCTGTAGGGCACCCAAAACTCAAGCAAGATGAGCTGTGCGCTGCT
CTGCAGGCTGGGGAGGTGCTGGGAGAGCCCTGGGTTCCGGTTGTTGATATTGTTTGCTGT
TGGGTTTTTGCTGCTTTTTTTTTTTTTTTTTT
Restriction Sites Please inquire     
ACCN NM_033163
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_033163.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033163.1, NP_149353.1
RefSeq Size 1107 bp
RefSeq ORF 735 bp
Locus ID 2253
UniProt ID P55075
Protein Families Druggable Genome, Secreted Protein
Protein Pathways MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
Gene Summary The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (F) encodes the longest isoform (F). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...