b9HSP (HSPB9) (NM_033194) Human Untagged Clone
CAT#: SC305594
HSPB9 (untagged)-Human heat shock protein, alpha-crystallin-related, B9 (HSPB9)
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT51 |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_033194 edited
CGCGCCCTTTGACAGCAGTTAGTTGCTGACTCGGATGCAGAGAGTCGGTAACACCTTCTC CAACGAGAGCCGGGTGGCATCCCGGTGTCCCAGCGTGGGCCTTGCTGAACGGAACCGGGT GGCCACAATGCCGGTGCGGCTGCTCAGGGACAGTCCAGCGGCTCAGGAGGACAATGACCA TGCCAGAGACGGTTTCCAAATGAAGCTGGATGCCCACGGCTTCGCCCCGGAGGAACTGGT GGTGCAGGTGGATGGCCAATGGCTGATGGTGACCGGACAGCAGCAACTGGACGTCAGGGA CCCGGAAAGGGTCAGTTACCGCATGTCACAGAAGGTGCACCGGAAAATGCTCCCGTCCAA CCTGAGTCCTACCGCCATGACCTGCTGCCTGACCCCCTCCGGGCAGCTGTGGGTCAGAGG CCAGTGTGTGGCGCTGGCCCTCCCTGAAGCCCAAACAGGACCGTCCCCGAGACTCGGGAG CCTCGGCTCTAAGGCTTCCAACCTGACCCGGTAAACAAACGACGCGATGTGCAGCAG |
| Restriction Sites | Please inquire |
| ACCN | NM_033194 |
| Insert Size | 500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_033194.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033194.1, NP_149971.1 |
| RefSeq Size | 480 bp |
| RefSeq ORF | 480 bp |
| Locus ID | 94086 |
| UniProt ID | Q9BQS6 |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210903 | HSPB9 (Myc-DDK-tagged)-Human heat shock protein, alpha-crystallin-related, B9 (HSPB9) |
CNY 1200.00 |
|
| RC210903L3 | Lenti ORF clone of Human heat shock protein, alpha-crystallin-related, B9 (HSPB9), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC210903L4 | Lenti ORF clone of Human heat shock protein, alpha-crystallin-related, B9 (HSPB9), mGFP tagged |
CNY 5890.00 |
|
| RG210903 | HSPB9 (tGFP-tagged) - Human heat shock protein, alpha-crystallin-related, B9 (HSPB9) |
CNY 2800.00 |
