SIGLECL1 (SIGLEC12) (NM_033329) Human Untagged Clone

CAT#: SC305613

SIGLEC12 (untagged)-Human sialic acid binding Ig-like lectin 12 (SIGLEC12), transcript variant 2



  "NM_033329" in other vectors (4)

CNY 7700.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SIGLEC12 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms S2V; Siglec-XII; SIGLECL1; SLG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305613 representing NM_033329.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGCTGCCCCTGCTATGGGCAAATGAAGAGAGGGACAGTGGGGGCTGGGCTGACCCTCGTTTCTCC
ACAGCGTCCCAGGACCTACTGTCAAGATACAGGCTGGAGGTGCCAGAGTCGGTGACTGTGCAGGAGGGT
CTGTGTGTCTCTGTGCCCTGCAGTGTCCTTTACCCCCATTACAACTGGACTGCCTCTAGCCCTGTTTAT
GGATCCTGGTTCAAGGAAGGGGCCGATATACCATGGGATATTCCAGTGGCCACAAACACCCCAAGTGGA
AAAGTGCAAGAGGATACCCACGGTCGATTCCTCCTCCTTGGGGACCCACAGACCAACAACTGCTCCCTG
AGCATCAGAGATGCCAGGAAGGGGGATTCAGGGAAGTACTACTTCCAGGTGGAGAGAGGAAGCAGGAAA
TGGAACTACATATATGACAAGCTCTCTGTGCATGTGACAGCCCTGACTCACATGCCCACCTTCTCCATC
CCGGGGACCCTGGAGTCTGGCCACCCCAGGAACCTGACCTGCTCTGTGCCCTGGGCCTGTGAACAGGGG
ACGCCCCCCACGATCACCTGGATGGGGGCCTCCGTGTCCTCCCTGGACCCCACTATCACTCGCTCCTCG
ATGCTCAGCCTCATCCCACAGCCCCAGGACCATGGCACCAGCCTCACCTGTCAGGTGACCTTGCCTGGG
GCCGGCGTGACCATGACCAGGGCTGTCCGACTCAACATATCCTATCCTCCTCAGAACTTGACCATGACT
GTCTTCCAAGGAGATGGCACAGCATCCACAACCTTGAGGAATGGCTCGGCCCTTTCAGTCCTGGAGGGC
CAGTCCCTGCACCTTGTCTGTGCTGTCGACAGCAATCCCCCTGCCAGGCTGAGCTGGACCTGGGGGAGC
CTGACCCTGAGCCCCTCACAGTCCTCGAACCTTGGGGTGCTGGAGCTGCCTCGAGTGCATGTGAAGGAT
GAAGGGGAATTCACCTGCCGAGCTCAGAACCCTCTAGGCTCCCAGCACATTTCCCTGAGCCTCTCCCTG
CAAAACGAGTACACAGGCAAAATGAGGCCTATATCAGGAGTGACGCTAGGGGCATTCGGGGGAGCTGGA
GCCACAGCCCTGGTCTTCCTGTACTTCTGCATCATCTTCGTTGTAGTGAGGTCCTGCAGGAAGAAATCG
GCAAGGCCAGCAGTGGGCGTGGGGGATACAGGCATGGAGGACGCAAACGCTGTCAGGGGCTCAGCCTCT
CAGGGACCCCTGATTGAATCCCCGGCAGATGACAGCCCCCCACACCATGCTCCGCCAGCCCTGGCCACC
CCCTCCCCAGAGGAAGGAGAGATCCAGTATGCATCCCTCAGCTTCCACAAAGCGAGGCCTCAGTACCCA
CAGGAACAGGAGGCCATCGGCTATGAGTACTCCGAGATCAACATCCCCAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_033329
Insert Size 1434 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033329.2
RefSeq Size 1868 bp
RefSeq ORF 1434 bp
Locus ID 89858
UniProt ID Q96PQ1
Protein Families Druggable Genome, Stem cell - Pluripotency, Transmembrane
MW 51.7 kDa
Gene Summary Sialic acid-binding immunoglobulin-like lectins (SIGLECs) are a family of cell surface proteins belonging to the immunoglobulin superfamily. They mediate protein-carbohydrate interactions by selectively binding to different sialic acid moieties present on glycolipids and glycoproteins. This gene encodes a member of the SIGLEC3-like subfamily of SIGLECs. Members of this subfamily are characterized by an extracellular V-set immunoglobulin-like domain followed by two C2-set immunoglobulin-like domains, and the cytoplasmic tyrosine-based motifs ITIM and SLAM-like. The encoded protein, upon tyrosine phosphorylation, has been shown to recruit the Src homology 2 domain-containing protein-tyrosine phosphatases SHP1 and SHP2. It has been suggested that the protein is involved in the negative regulation of macrophage signaling by functioning as an inhibitory receptor. This gene is located in a cluster with other SIGLEC3-like genes on 19q13.4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2), also known as SLG-Short (SLG-S), differs in the 5' UTR and uses an alternate segment in the 5' coding region compared to variant 1, resulting in the use of an alternate in-frame translation initiation codon. It encodes an isoform (b) with a different and shorter N-terminus compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...