Caveolin 3 (CAV3) (NM_033337) Human Untagged Clone

CAT#: SC305616

CAV3 (untagged)-Human caveolin 3 (CAV3), transcript variant 1



  "NM_033337" in other vectors (6)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-CAV3 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LGMD1C; LQT9; MPDT; RMD2; VIP-21; VIP21
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_033337 edited
CGATGATGGCAGAAGAGCACACAGATCTCGAGGCCCAGATCGTCAAGGATATCCACTGCA
AGGAGATTGACCTGGTGAACCGAGACCCCAAGAACATTAACGAGGACATAGTCAAGGTGG
ATTTTGAAGACGTGATCGCAGAGCCTGTGGGCACCTACAGCTTTGACGGCGTGTGGAAGG
TGAGCTACACCACCTTCACTGTCTCCAAGTACTGGTGCTACCGTCTGTTGTCCACGCTGC
TGGGCGTCCCACTGGCCCTGCTCTGGGGCTTCCTGTTCGCCTGCATCTCCTTCTGCCACA
TCTGGGCGGTGGTGCCATGCATTAAGAGCTACCTGATCGAGATCCAGTGCATCAGCCACA
TCTACTCACTCTGCATCCGCACCTTCTGCAACCCACTCTTCGCGGCCCTGGGCCAGGTCT
GCAGCAGCATCAAGGTGGTGCTGCGGAAGGAGGTCTAAAGCCAGGTGGGGCAACAGCGGT
GGCAGGGCAGGGGGTGGTGGGCCAGACTGGTCCCCGGGGGACTTCTTCACAGGGGCTGCT
GGCGAGCTCTTTCTCTTTAGGGACTGCTCCATACCCCATGATGGAGCACACGGTGTAGGG
AAGCCAGAAAGAAAAGA
Restriction Sites Please inquire     
ACCN NM_033337
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_033337.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033337.1, NP_203123.1
RefSeq Size 1425 bp
RefSeq ORF 456 bp
Locus ID 859
UniProt ID P56539
Protein Families Druggable Genome, Transmembrane
Protein Pathways Focal adhesion
Gene Summary This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) is longer than variant 2, since it includes a differentially spliced intron located in the 3' UTR, but both transcripts encode identical proteins.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...