SBEM (MUCL1) (NM_058173) Human Untagged Clone
CAT＃: SC305756
MUCL1 (untagged)-Human mucin-like 1 (MUCL1)
CNY 1200.00
CNY 3990.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SBEM |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF within SC305756 sequence for NM_058173 edited (data generated by NextGen Sequencing)
ATGAAGTTCTTAGCAGTCCTGGTACTCTTGGGAGTTTCCATCTTTCTGGTCTCTGCCCAG AATCCGACAACAGCTGCTCCAGCTGACACGTATCCAGCTACTGGTCCTGCTGATGATGAA GCCCCTGATGCTGAAACCACTGCTGCTGCAACCACTGCAACCACTGCTGCTCCTACCACT GCAACCACCGCTGCTTCTACCACTGCTCGTAAAGACATTCCAGTTTTACCCAAATGGGTT GGGGATCTCCCGAATGGTAGAGTGTGTCCCTGA Clone variation with respect to NM_058173.2 |
| Restriction Sites | Please inquire |
| ACCN | NM_058173 |
| Insert Size | 300 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This is not a varient, and the ORF perfectly matches with reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_058173.1, NP_477521.1 |
| RefSeq Size | 396 bp |
| RefSeq ORF | 273 bp |
| Locus ID | 118430 |
| UniProt ID | Q96DR8 |
| Protein Families | Secreted Protein |
| Gene Summary | May play a role as marker for the diagnosis of metastatic breast cancer.[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
The mucin protein MUCL1 regulates melanogenesis and melanoma genes in a manner dependent on threonine content *
,null,
The British Journal of Dermatology
,PubMed ID 34545566
[SBEM]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213754 | MUCL1 (Myc-DDK-tagged)-Human mucin-like 1 (MUCL1) |
CNY 1200.00 |
|
| RC213754L1 | Lenti ORF clone of Human mucin-like 1 (MUCL1), Myc-DDK-tagged |
CNY 3600.00 |
|
| RC213754L2 | Lenti ORF clone of Human mucin-like 1 (MUCL1), mGFP tagged |
CNY 5890.00 |
|
| RC213754L3 | Lenti ORF clone of Human mucin-like 1 (MUCL1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC213754L4 | Lenti ORF clone of Human mucin-like 1 (MUCL1), mGFP tagged |
CNY 5890.00 |
|
| RG213754 | MUCL1 (tGFP-tagged) - Human mucin-like 1 (MUCL1) |
CNY 2800.00 |
