WFDC6 (NM_080827) Human Untagged Clone
CAT#: SC305856
WFDC6 (untagged)-Human WAP four-disulfide core domain 6 (WFDC6)
CNY 1800.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C20orf171; dJ461P17.11; HEL-S-295; WAP6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_080827, the custom clone sequence may differ by one or more nucleotides
ATGGGACTCTCAGGACTTCTGCCAATCCTGGTACCATTCATCCTTTTGGGGGACATCCAGGAACCTGGGC ACGCTGAAGGCATCCTTGGCAAGCCGTGTCCCAAAATCAAAGTGGAATGCGAAGTGGAAGAAATAGACCA GTGTACCAAACCCAGAGATTGCCCAGAAAACATGAAGTGTTGCCCGTTCAGCCGTGGAAAGAAATGTTTA GACTTCAGAAAGGTCAGCCTTACTTTATACCATAAGGAGGAGCTTGAATAA |
Restriction Sites | Please inquire |
ACCN | NM_080827 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_080827.1, NP_543017.1 |
RefSeq Size | 619 bp |
RefSeq ORF | 261 bp |
Locus ID | 140870 |
UniProt ID | Q9BQY6 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Read-through transcription exists between this gene and the upstream SPINLW1 (serine peptidase inhibitor-like, with Kunitz and WAP domains 1) gene. [provided by RefSeq, Nov 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210952 | WFDC6 (Myc-DDK-tagged)-Human WAP four-disulfide core domain 6 (WFDC6) |
CNY 1800.00 |
|
RC210952L3 | Lenti ORF clone of Human WAP four-disulfide core domain 6 (WFDC6), Myc-DDK-tagged |
CNY 5890.00 |
|
RC210952L4 | Lenti ORF clone of Human WAP four-disulfide core domain 6 (WFDC6), mGFP tagged |
CNY 5890.00 |
|
RG210952 | WFDC6 (tGFP-tagged) - Human WAP four-disulfide core domain 6 (WFDC6) |
CNY 3400.00 |