XAGE3 (NM_130776) Human Untagged Clone
CAT#: SC305903
XAGE3 (untagged)-Human X antigen family, member 3 (XAGE3), transcript variant 2
CNY 1200.00
CNY 3990.00
Product images
 
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | CT12.3a; CT12.3b; GAGED4; PLAC6; pp9012; XAGE-3 | 
| Vector | pCMV6-AC | 
| E. coli Selection | Ampicillin (100 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | >OriGene sequence for NM_130776 edited GAATTCGGCCATTACGGCCGGGGGTGGTGAATGCCCTGGAGTTGTGAGGGTGTGAGGGTC GCGTTCCTGCTGTCTGGACTTTTTCTGTCCCACTGAGACGCAGCTGTGTGAAATATGATT TGGCGAGGAAGATCAACATATAGGCCTAGGCCGAGGAGAAGTGTACCACCTCCTGAGCTG ATTGGGCCTATGCTGGAGCCCGGTGATGAGGAGCCTCAGCAAGAGGAACCACCAACTGAA AGTCGGGATCCTGCACCTGGTCAGGAGAGAGAAGAAGATCAGGGTGCAGCTGAGACTCAA GTGCCTGACCTGGAAGCTGATCTCCAGGAGCTGTCTCAGTCAAAGACTGGGGGTGAATGT GGAAATGGTCCTGATGACCAGGGGAAGATTCTGCCAAAATCAGAACAATTTAAAATGCCA GAAGGAGGTGACAGGCAACCACAGGTTTAAATGAAGACAAGCTGAAACAACACAAAACTG TTTTTATCTAAGATATTTGACTTAAAAATATCGAAATAAACTTTTGCAGCTTTCTCCTAA AAAAAAAAAAAAAAAAAAAAAAAAACATGTCGGCCGCCTCGGCCCTCGAG | 
| Restriction Sites | Please inquire | 
| ACCN | NM_130776 | 
| Insert Size | 600 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| OTI Annotation | It was fully sequenced and the DNA sequence matches with that of NM_130776.1. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. | 
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_130776.1, NP_570132.1 | 
| RefSeq Size | 493 bp | 
| RefSeq ORF | 336 bp | 
| Locus ID | 170626 | 
| UniProt ID | Q8WTP9 | 
| Gene Summary | This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is expressed in placenta and fetal liver/spleen, and may function in inhibiting cancer cell growth. The protein encoded by this gene shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene generates 2 transcript variants differing in the 5' UTR. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has an alternate exon 1, as compared to variant 1. It thus has a different and shorter 5' UTR, but encodes the same protein as variant 1. | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC209351 | XAGE3 (Myc-DDK-tagged)-Human X antigen family, member 3 (XAGE3), transcript variant 2 | 
                                                        
                                                        
                                                        
                                                            CNY 1200.00 | |
| RC209351L3 | Lenti ORF clone of Human X antigen family, member 3 (XAGE3), transcript variant 2, Myc-DDK-tagged | CNY 5890.00 | |
| RC209351L4 | Lenti ORF clone of Human X antigen family, member 3 (XAGE3), transcript variant 2, mGFP tagged | CNY 5890.00 | |
| RG209351 | XAGE3 (tGFP-tagged) - Human X antigen family, member 3 (XAGE3), transcript variant 2 | CNY 4370.00 | 

 
        