RAET1L (NM_130900) Human Untagged Clone

CAT#: SC305926

RAET1L (untagged)-Human retinoic acid early transcript 1L (RAET1L)



  "NM_130900" in other vectors (6)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ULBP6
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_130900 edited
ATGGCAGCAGCCGCCATCCCAGCTTTGCTTCTGTGCCTCCCGCTTCTGTTCCTGCTGTTC
GGCTGGTCCCGGGCTAGGCGAGACGACCCTCACTCTCTTTGCTATGACATCACCGTCATC
CCTAAGTTCAGACCTGGACCACGGTGGTGTGCGGTTCAAGGCCAGGTGGATGAAAAGACT
TTTCTTCACTATGACTGTGGCAACAAGACAGTCACACCCGTCAGTCCCCTGGGGAAGAAA
CTAAATGTCACAATGGCCTGGAAAGCACAGAACCCAGTACTGAGAGAGGTGGTGGACATA
CTTACAGAGCAACTGCTTGACATTCAGCTGGAGAATTACACACCCAAGGAACCCCTCACC
CTGCAGGCAAGGATGTCTTGTGAGCAGAAAGCTGAAGGACACAGCAGTGGATCTTGGCAG
TTCAGTATCGATGGACAGACCTTCCTACTCTTTGACTCAGAGAAGAGAATGTGGACAACG
GTTCATCCTGGAGCCAGAAAGATGAAAGAAAAGTGGGAGAATGACAAGGATGTGGCCATG
TCCTTCCATTACATCTCAATGGGAGACTGCATAGGATGGCTTGAGGACTTCTTGATGGGC
ATGGACAGCACCCTGGAGCCAAGTGCAGGAGCACCACTCGCCATGTCCTCAGGCACAACC
CAACTCAGGGCCACAGCCACCACCCTCATCCTTTGCTGCCTCCTCATCATCCTCCCCTGC
TTCATCCTCCCTGGCATCTGA
Restriction Sites Please inquire     
ACCN NM_130900
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_130900.1, NP_570970.1
RefSeq Size 741 bp
RefSeq ORF 741 bp
Locus ID 154064
UniProt ID Q5VY80
Protein Families Druggable Genome, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity
Gene Summary RAET1L belongs to the RAET1 family of major histocompatibility complex (MHC) class I-related genes, which are located within a 180-kb cluster on chromosome 6q24.2-q25.3. The REAT1 genes encode glycoproteins that contain extracellular alpha-1 and alpha-2 domains, but they lack the membrane proximal Ig-like alpha-3 domain. Most RAET1 glycoproteins are anchored to the membrane via glycosylphosphatidylinositol (GPI) linkage (Radosavljevic et al., 2002 [PubMed 11827464]).[supplied by OMIM, Mar 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...