RAET1L (NM_130900) Human Untagged Clone
CAT#: SC305926
RAET1L (untagged)-Human retinoic acid early transcript 1L (RAET1L)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ULBP6 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_130900 edited
ATGGCAGCAGCCGCCATCCCAGCTTTGCTTCTGTGCCTCCCGCTTCTGTTCCTGCTGTTC GGCTGGTCCCGGGCTAGGCGAGACGACCCTCACTCTCTTTGCTATGACATCACCGTCATC CCTAAGTTCAGACCTGGACCACGGTGGTGTGCGGTTCAAGGCCAGGTGGATGAAAAGACT TTTCTTCACTATGACTGTGGCAACAAGACAGTCACACCCGTCAGTCCCCTGGGGAAGAAA CTAAATGTCACAATGGCCTGGAAAGCACAGAACCCAGTACTGAGAGAGGTGGTGGACATA CTTACAGAGCAACTGCTTGACATTCAGCTGGAGAATTACACACCCAAGGAACCCCTCACC CTGCAGGCAAGGATGTCTTGTGAGCAGAAAGCTGAAGGACACAGCAGTGGATCTTGGCAG TTCAGTATCGATGGACAGACCTTCCTACTCTTTGACTCAGAGAAGAGAATGTGGACAACG GTTCATCCTGGAGCCAGAAAGATGAAAGAAAAGTGGGAGAATGACAAGGATGTGGCCATG TCCTTCCATTACATCTCAATGGGAGACTGCATAGGATGGCTTGAGGACTTCTTGATGGGC ATGGACAGCACCCTGGAGCCAAGTGCAGGAGCACCACTCGCCATGTCCTCAGGCACAACC CAACTCAGGGCCACAGCCACCACCCTCATCCTTTGCTGCCTCCTCATCATCCTCCCCTGC TTCATCCTCCCTGGCATCTGA |
Restriction Sites | Please inquire |
ACCN | NM_130900 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_130900.1, NP_570970.1 |
RefSeq Size | 741 bp |
RefSeq ORF | 741 bp |
Locus ID | 154064 |
UniProt ID | Q5VY80 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Natural killer cell mediated cytotoxicity |
Gene Summary | RAET1L belongs to the RAET1 family of major histocompatibility complex (MHC) class I-related genes, which are located within a 180-kb cluster on chromosome 6q24.2-q25.3. The REAT1 genes encode glycoproteins that contain extracellular alpha-1 and alpha-2 domains, but they lack the membrane proximal Ig-like alpha-3 domain. Most RAET1 glycoproteins are anchored to the membrane via glycosylphosphatidylinositol (GPI) linkage (Radosavljevic et al., 2002 [PubMed 11827464]).[supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215850 | RAET1L (Myc-DDK-tagged)-Human retinoic acid early transcript 1L (RAET1L) |
CNY 2400.00 |
|
RC215850L1 | Lenti ORF clone of Human retinoic acid early transcript 1L (RAET1L), Myc-DDK-tagged |
CNY 4800.00 |
|
RC215850L2 | Lenti ORF clone of Human retinoic acid early transcript 1L (RAET1L), mGFP tagged |
CNY 5890.00 |
|
RC215850L3 | Lenti ORF clone of Human retinoic acid early transcript 1L (RAET1L), Myc-DDK-tagged |
CNY 5890.00 |
|
RC215850L4 | Lenti ORF clone of Human retinoic acid early transcript 1L (RAET1L), mGFP tagged |
CNY 4800.00 |
|
RG215850 | RAET1L (tGFP-tagged) - Human retinoic acid early transcript 1L (RAET1L) |
CNY 4370.00 |