PTCRA (NM_138296) Human Untagged Clone
CAT#: SC306002
PTCRA (untagged)-Human pre T-cell antigen receptor alpha (PTCRA)
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PT-ALPHA; PTA |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_138296 edited
TCCTGCCTCCTTCCGAGTGGGCCATGGCCGGTACATGGCTGCTACTTCTCCTGGCCCTTG GGTGTCCAGCCCTACCCACAGGTGTGGGCGGCACACCCTTTCCTTCTCTGGCCCCACCAA TCATGCTGCTGGTGGATGGAAAGCAGCAGATGGTGGTGGTCTGCCTGGTCCTTGATGTTG CACCCCCTGGCCTTGACAGCCCCATCTGGTTCTCAGCCGGCAATGGCAGTGCACTGGATG CCTTCACCTATGGCCCTTCCCCAGCAACGGATGGCACCTGGACCAACTTGGCCCATCTCT CCCTGCCTTCTGAGGAGCTGGCATCCTGGGAGCCTTTGGTCTGCCACACTGGGCCTGGGG CTGAGGGTCACAGCAGGAGTACACAGCCCATGCATCTGTCAGGAGAGGCTTCTACAGCCA GGACCTGCCCCCAGGAGCCTCTCAGGGGGACACCGGGTGGGGCGCTGTGGCTGGGGGTCC TGCGGCTGCTGCTCTTCAAGCTGCTGCTGTTTGACCTGCTCCTGACCTGCAGCTGCCTGT GCGACCCCGCGGGCCCGCTGCCTTCCCCCGCAACCACCACCCGCCTGCGAGCCCTCGGCT CCCATCGACTGCACCCGGCCACGGAGACTGGGGGACGAGAGGCCACCAGCTCACCCAGAC CCCAGCCTCGGGACCGCCGCTGGGGTGACACCCCTCCGGGTCGGAAGCCCGGGAGCCCAG TATGGGGGGAAGGGTCTTACCTCAGCAGTTACCCCACTTGCCCAGCACAGGCCTGGTGCT CAAGATCTGCCCTCAGGGCTCCTTCCTCCAGTCTTGGAGCATTTTTTGCAGGTGACCTGC CTCCTCCTCTGCAGGCTGGAGCTGCCTGAGGGCAGGGCTCTACCTCCCCTGCGTCACACT GTGTGAGGCTGTGTCTCTGCCATCCAAAAGGGGGCCCCTTGAGAATGGTGATCCACCCAG TTACAGGGGCATTTAGGGAGCAGATGACTGAG |
| Restriction Sites | Please inquire |
| ACCN | NM_138296 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_138296.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_138296.1, NP_612153.1 |
| RefSeq Size | 1080 bp |
| RefSeq ORF | 846 bp |
| Locus ID | 171558 |
| UniProt ID | Q6ISU1 |
| Protein Families | Transmembrane |
| Protein Pathways | Notch signaling pathway |
| Gene Summary | The protein encoded by this gene is a single-pass type I membrane protein that is found in immmature but not mature T-cells. Along with TCRB and CD3 complex, the encoded protein forms the pre-T-cell receptor complex, which regulates early T-cell development. Four transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011] Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) lacks an alternate internal segment compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215794 | PTCRA (Myc-DDK-tagged)-Human pre T-cell antigen receptor alpha (PTCRA) |
CNY 2400.00 |
|
| RC215794L1 | Lenti-ORF clone of PTCRA (Myc-DDK-tagged)-Human pre T-cell antigen receptor alpha (PTCRA) |
CNY 4800.00 |
|
| RC215794L2 | Lenti-ORF clone of PTCRA (mGFP-tagged)-Human pre T-cell antigen receptor alpha (PTCRA) |
CNY 5890.00 |
|
| RC215794L3 | Lenti-ORF clone of PTCRA (Myc-DDK-tagged)-Human pre T-cell antigen receptor alpha (PTCRA) |
CNY 5890.00 |
|
| RC215794L4 | Lenti-ORF clone of PTCRA (mGFP-tagged)-Human pre T-cell antigen receptor alpha (PTCRA) |
CNY 5890.00 |
|
| RG215794 | PTCRA (tGFP-tagged) - Human pre T-cell antigen receptor alpha (PTCRA) |
CNY 4000.00 |
