Kallikrein 7 (KLK7) (NM_139277) Human Untagged Clone
CAT#: SC306137
KLK7 (untagged)-Human kallikrein-related peptidase 7 (KLK7), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | hK7; PRSS6; SCCE |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306137 representing NM_139277.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAAGATCCCTTCTCCTGCCCCTGCAGATCTTACTGCTATCCTTAGCCTTGGAAACTGCAGGAGAA GAAGCCCAGGGTGACAAGATTATTGATGGCGCCCCATGTGCAAGAGGCTCCCACCCATGGCAGGTGGCC CTGCTCAGTGGCAATCAGCTCCACTGCGGAGGCGTCCTGGTCAATGAGCGCTGGGTGCTCACTGCCGCC CACTGCAAGATGAATGAGTACACCGTGCACCTGGGCAGTGATACGCTGGGCGACAGGAGAGCTCAGAGG ATCAAGGCCTCGAAGTCATTCCGCCACCCCGGCTACTCCACACAGACCCATGTTAATGACCTCATGCTC GTGAAGCTCAATAGCCAGGCCAGGCTGTCATCCATGGTGAAGAAAGTCAGGCTGCCCTCCCGCTGCGAA CCCCCTGGAACCACCTGTACTGTCTCCGGCTGGGGCACTACCACGAGCCCAGATGTGACCTTTCCCTCT GACCTCATGTGCGTGGATGTCAAGCTCATCTCCCCCCAGGACTGCACGAAGGTTTACAAGGACTTACTG GAAAATTCCATGCTGTGCGCTGGCATCCCCGACTCCAAGAAAAACGCCTGCAATGGTGACTCAGGGGGA CCGTTGGTGTGCAGAGGTACCCTGCAAGGTCTGGTGTCCTGGGGAACTTTCCCTTGCGGCCAACCCAAT GACCCAGGAGTCTACACTCAAGTGTGCAAGTTCACCAAGTGGATAAATGACACCATGAAAAAGCATCGC TAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_139277 |
| Insert Size | 762 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_139277.2 |
| RefSeq Size | 1934 bp |
| RefSeq ORF | 762 bp |
| Locus ID | 5650 |
| UniProt ID | P49862 |
| Protein Families | Druggable Genome, Secreted Protein |
| MW | 27.5 kDa |
| Gene Summary | This gene encodes a member of the kallikrein subfamily of serine proteases. These enzymes have diverse physiological functions and many kallikrein genes are biomarkers for cancer. The encoded protein has chymotrypsin-like activity and plays a role in the proteolysis of intercellular cohesive structures that precedes desquamation, the shedding of the outermost layer of the epidermis. The encoded protein may play a role in cancer invasion and metastasis, and increased expression of this gene is associated with unfavorable prognosis and progression of several types of cancer. Polymorphisms in this gene may play a role in the development of atopic dermatitis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, which is one of fifteen kallikrein subfamily members located in a gene cluster on chromosome 19. [provided by RefSeq, May 2011] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly, which represents the 'AACCAACC' allele with regards to the 3' UTR polymorphism described in PMID 15191543. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213930 | KLK7 (Myc-DDK-tagged)-Human kallikrein-related peptidase 7 (KLK7), transcript variant 2 |
CNY 2400.00 |
|
| RC213930L3 | Lenti ORF clone of Human kallikrein-related peptidase 7 (KLK7), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC213930L4 | Lenti ORF clone of Human kallikrein-related peptidase 7 (KLK7), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG213930 | KLK7 (tGFP-tagged) - Human kallikrein-related peptidase 7 (KLK7), transcript variant 2 |
CNY 4370.00 |
其它Kallikrein 7产品
