RHOXF1 (NM_139282) Human Untagged Clone

CAT#: SC306139

RHOXF1 (untagged)-Human Rhox homeobox family, member 1 (RHOXF1)



  "NM_139282" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-RHOXF1 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OTEX; PEPP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306139 representing NM_139282.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCGTTCGCTCGTCCACGACACCGTGTTCTACTGCCTGAGTGTATACCAGGTAAAAATAAGCCCC
ACACCTCAGCTGGGGGCAGCATCAAGCGCAGAAGGCCATGTTGGCCAAGGAGCTCCAGGCCTCATGGGT
AATATGAACCCTGAGGGCGGTGTGAACCACGAGAACGGCATGAACCGCGATGGCGGCATGATCCCCGAG
GGCGGCGGTGGAAACCAGGAGCCTCGGCAGCAGCCGCAGCCCCCGCCGGAGGAGCCGGCCCAGGCGGCC
ATGGAGGGTCCGCAGCCCGAGAACATGCAGCCACGAACTCGGCGCACGAAGTTCACGCTGTTGCAGGTG
GAGGAGCTGGAAAGTGTTTTCCGACACACTCAATACCCTGATGTGCCCACAAGAAGGGAACTTGCCGAA
AACTTAGGTGTGACTGAAGACAAAGTGCGGGTTTGGTTTAAGAATAAAAGGGCCAGATGTAGGCGACAT
CAGAGAGAATTAATGCTCGCCAATGAACTACGTGCTGACCCAGACGACTGTGTCTACATCGTCGTGGAC
TAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_139282
Insert Size 555 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_139282.2
RefSeq Size 780 bp
RefSeq ORF 555 bp
Locus ID 158800
UniProt ID Q8NHV9
Protein Families Druggable Genome, Transcription Factors
MW 20.5 kDa
Gene Summary This gene is a member of the PEPP subfamily of paired-like homoebox genes. The gene may be regulated by androgens and epigenetic mechanisms. The encoded nuclear protein is likely a transcription factor that may play a role in human reproduction. [provided by RefSeq, Dec 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...