IBRDC1 (RNF217) (NM_152553) Human Untagged Clone
CAT＃: SC306438
RNF217 (untagged)-Human ring finger protein 217 (RNF217)
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C6orf172; dJ84N20.1; IBRDC1; OSTL |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306438 representing NM_152553.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGGTACAACTTGGCCAAGTAGAAATCAAATGCCCCATCACAGAGTGTTTTGAATTCTTGGAAGAA ACAACTGTTGTCTATAACTTAACGCATGAAGACTCCATCAAGTATAAGTACTTCTTGGAACTTGGCCGT ATTGATTCCAGCACCAAGCCATGTCCTCAGTGCAAGCACTTTACAACCTTCAAGAAAAAAGGACATATT CCCACCCCTTCCAGATCAGAAAGCAAATACAAAATCCAGTGCCCTACCTGCCAATTCGTCTGGTGTTTT AAGTGCCACTCTCCTTGGCATGAAGGTGTTAACTGCAAGGAGTACAAAAAAGGAGACAAATTGTTGCGT CACTGGGCCAGCGAAATTGAGCATGGGCAGAGGAATGCCCAGAAGTGTCCAAAGTGCAAGATCCACATC CAGCGAACTGAAGGATGTGACCATATGACCTGCTCACAATGTAACACTAATTTTTGTTACCGATGTGGT GAGAGATACCGCCAGCTCCGATTTTTTGGAGACCACACATCAAACCTCAGTATATTTGGATGCAAATAT CGCTACCTCCCAGAGAGACCTCATTTAAGGAGATTAGTGCGAGGGTCAGTCTGTGCTGGAAAATTATTC ATTGCACCTCTAATTATGGTTTTGGGATTGGCACTAGGGGCCATAGCGGTTGTAATCGTTGAGGAAATT AAGACTTACTGGAACCTCATAAGTGGTAGAACCAGGAATCAAACCCAACATTTGGCTCCACAGCCTGTG TTGTTAAGTGATATGCTATACTGCCTGAAACAAGTGTTTATTTGTATTTCCTATCTATTGCCTTTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_152553 |
| Insert Size | 828 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_152553.4 |
| RefSeq Size | 10907 bp |
| RefSeq ORF | 828 bp |
| Locus ID | 154214 |
| UniProt ID | Q8TC41 |
| Protein Families | Transmembrane |
| MW | 32 kDa |
| Gene Summary | This protein encoded by this gene is a member of the RING1-IBR-RING24 (RBR) ubiquitin protein ligase family, and it belongs to a subfamily of these proteins that contain a transmembrane domain. This protein can interact with the HAX1 anti-apoptotic protein via its C-terminal RING finger motif, which suggests a role in apoptosis signaling. It is thought that deregulation of this gene can be a mechanism in leukemogenesis. Mutations in the region encoding the protein GXXXG motif, which appears to be necessary for protein self-association, have been found in human cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016] Transcript Variant: This variant (2) contains alternate 5' exon structure and it thus differs in the 5' UTR and 5' coding region, and it includes an additional exon that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (b) has distinct N- and C-termini and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205568 | RNF217 (Myc-DDK-tagged)-Human ring finger protein 217 (RNF217) |
CNY 2400.00 |
|
| RC205568L3 | Lenti ORF clone of Human ring finger protein 217 (RNF217), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC205568L4 | Lenti ORF clone of Human ring finger protein 217 (RNF217), mGFP tagged |
CNY 5890.00 |
|
| RG205568 | RNF217 (tGFP-tagged) - Human ring finger protein 217 (RNF217) |
CNY 4000.00 |
