United States
Germany
Japan
United Kingdom
China
CD30 (TNFRSF8) (NM_152942) Human Untagged Clone
CAT＃: SC306527
TNFRSF8 (untagged)-Human tumor necrosis factor receptor superfamily, member 8 (TNFRSF8), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD30; D1S166E; Ki-1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_152942, the custom clone sequence may differ by one or more nucleotides
ATGAGCCAGCCACTGATGGAGACCTGCCACAGCGTGGGGGCAGCCTACCTGGAGAGCCTG CCGCTGCAGGATGCCAGCCCGGCCGGGGGCCCCTCGTCCCCCAGGGACCTTCCTGAGCCC CGGGTGTCCACGGAGCACACCAATAACAAGATTGAGAAAATCTACATCATGAAGGCTGAC ACCGTGATCGTGGGGACCGTGAAGGCTGAGCTGCCGGAGGGCCGGGGCCTGGCGGGGCCA GCAGAGCCCGAGTTGGAGGAGGAGCTGGAGGCGGACCATACCCCCCACTACCCCGAGCAG GAGACAGAACCGCCTCTGGGCAGCTGCAGCGATGTCATGCTCTCAGTGGAAGAGGAAGGG AAAGAAGACCCCTTGCCCACAGCTGCCTCTGGAAAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_152942 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_152942.2, NP_694421.1 |
| RefSeq Size | 2361 bp |
| RefSeq ORF | 399 bp |
| Locus ID | 943 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Stem cell - Pluripotency, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (2) has a shorter N-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219886 | TNFRSF8 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 8 (TNFRSF8), transcript variant 2 |
CNY 3,990.00 |
|
| RC219886L3 | Lenti-ORF clone of TNFRSF8 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 8 (TNFRSF8), transcript variant 2 |
CNY 5,890.00 |
|
| RC219886L4 | Lenti-ORF clone of TNFRSF8 (mGFP-tagged)-Human tumor necrosis factor receptor superfamily, member 8 (TNFRSF8), transcript variant 2 |
CNY 5,890.00 |
|
| RG219886 | TNFRSF8 (tGFP-tagged) - Human tumor necrosis factor receptor superfamily, member 8 (TNFRSF8), transcript variant 2 |
CNY 4,370.00 |
其它TNFRSF8产品
