ITGB1BP3 (NMRK2) (NM_170678) Human Untagged Clone

CAT#: SC306679

NMRK2 (untagged)-Human integrin beta 1 binding protein 3 (ITGB1BP3)



  "NM_170678" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ITGB1BP3 mouse monoclonal antibody,clone OTI1A12
    • 100 ul

CNY 1999.00
CNY 2700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ITGB1BP3; MIBP; NRK2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_170678 edited
CACTGCGTGGTCGCACCCTACCCGGGCTGCCTTGGAAGTCGTCCCCGCCGCCCCTCCGCA
CCGGCATGAAGCTCATCGTGGGCATCGGAGGCATGACCAACGGCGGCAAGACCACGCTGA
CCAACAGCCTGCTCAGAGCCCTGCCCAACTGCTGCGTGATCCATCAGGATGACTTCTTCA
AGCCCCAAGACCAAATAGCAGTTGGGGAAGACGGCTTCAAACAGTGGGACGTGCTGGAGT
CTCTGGACATGGAGGCCATGCTGGACACCGTGCAGGCCTGGCTGAGCAGCCCGCAGAAGT
TTGCCCGTGCCCACGGGGTCAGCGTCCAGCCAGAGGCCTCGGACACCCACATCCTCCTCC
TGGAAGGCTTCCTGCTCTACAGCTACAAGCCCCTGGTGGACTTGTACAGCCGCCGGTACT
TCCTGACCGTCCCGTATGAAGAGTGCAAGTGGAGGAGAAGTACCCGCAACTACACAGTCC
CTGATCCCCCCGGCCTCTTCGATGGCCACGTGTGGCCCATGTACCAGAAGTATAGGCAGG
AGATGGAGGCCAACGGTGTGGAAGTGGTCTACCTGGACGGCATGAAGTCCCGAGAGGAGC
TCTTCCGTGAAGTCCTGGAAGACATTCAGAACTCGCTGCTGAACCGCTCCCAGGAATCAG
CCCCCTCCCCGGCTCGCCCAGCCAGGACACAGGGACCCGGACGCGGATGCGGCCACAGAA
CGGCCAGGCCTGCAGCGTCCCAGCAGGACAGCATGTGAGCGTTTCCCTATGGGGGTGTCT
GTACGTAGGAGAGTGGAGGCCCCACTCCCAGTTGGGCGTCCCGGAGCTCAGGGACTGAGC
CCCAAGACGCCTC
Restriction Sites Please inquire     
ACCN NM_170678
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_170678.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_170678.1, NP_733778.1
RefSeq Size 1134 bp
RefSeq ORF 693 bp
Locus ID 27231
UniProt ID Q9NPI5
Gene Summary Catalyzes the phosphorylation of nicotinamide riboside (NR) and nicotinic acid riboside (NaR) to form nicotinamide mononucleotide (NMN) and nicotinic acid mononucleotide (NaMN). Reduces laminin matrix deposition and cell adhesion to laminin, but not to fibronectin. Involved in the regulation of PXN at the protein level and of PXN tyrosine phosphorylation. May play a role in the regulation of terminal myogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...