ITGB1BP3 (NMRK2) (NM_170678) Human Untagged Clone
CAT＃: SC306679
NMRK2 (untagged)-Human integrin beta 1 binding protein 3 (ITGB1BP3)
CNY 2400.00
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ITGB1BP3; MIBP; NRK2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_170678 edited
CACTGCGTGGTCGCACCCTACCCGGGCTGCCTTGGAAGTCGTCCCCGCCGCCCCTCCGCA CCGGCATGAAGCTCATCGTGGGCATCGGAGGCATGACCAACGGCGGCAAGACCACGCTGA CCAACAGCCTGCTCAGAGCCCTGCCCAACTGCTGCGTGATCCATCAGGATGACTTCTTCA AGCCCCAAGACCAAATAGCAGTTGGGGAAGACGGCTTCAAACAGTGGGACGTGCTGGAGT CTCTGGACATGGAGGCCATGCTGGACACCGTGCAGGCCTGGCTGAGCAGCCCGCAGAAGT TTGCCCGTGCCCACGGGGTCAGCGTCCAGCCAGAGGCCTCGGACACCCACATCCTCCTCC TGGAAGGCTTCCTGCTCTACAGCTACAAGCCCCTGGTGGACTTGTACAGCCGCCGGTACT TCCTGACCGTCCCGTATGAAGAGTGCAAGTGGAGGAGAAGTACCCGCAACTACACAGTCC CTGATCCCCCCGGCCTCTTCGATGGCCACGTGTGGCCCATGTACCAGAAGTATAGGCAGG AGATGGAGGCCAACGGTGTGGAAGTGGTCTACCTGGACGGCATGAAGTCCCGAGAGGAGC TCTTCCGTGAAGTCCTGGAAGACATTCAGAACTCGCTGCTGAACCGCTCCCAGGAATCAG CCCCCTCCCCGGCTCGCCCAGCCAGGACACAGGGACCCGGACGCGGATGCGGCCACAGAA CGGCCAGGCCTGCAGCGTCCCAGCAGGACAGCATGTGAGCGTTTCCCTATGGGGGTGTCT GTACGTAGGAGAGTGGAGGCCCCACTCCCAGTTGGGCGTCCCGGAGCTCAGGGACTGAGC CCCAAGACGCCTC |
| Restriction Sites | Please inquire |
| ACCN | NM_170678 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_170678.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_170678.1, NP_733778.1 |
| RefSeq Size | 1134 bp |
| RefSeq ORF | 693 bp |
| Locus ID | 27231 |
| UniProt ID | Q9NPI5 |
| Gene Summary | Catalyzes the phosphorylation of nicotinamide riboside (NR) and nicotinic acid riboside (NaR) to form nicotinamide mononucleotide (NMN) and nicotinic acid mononucleotide (NaMN). Reduces laminin matrix deposition and cell adhesion to laminin, but not to fibronectin. Involved in the regulation of PXN at the protein level and of PXN tyrosine phosphorylation. May play a role in the regulation of terminal myogenesis.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210779 | NMRK2 (Myc-DDK-tagged)-Human integrin beta 1 binding protein 3 (ITGB1BP3) |
CNY 3600.00 |
|
| RC210779L3 | Lenti-ORF clone of NMRK2 (Myc-DDK-tagged)-Human integrin beta 1 binding protein 3 (ITGB1BP3) |
CNY 5890.00 |
|
| RC210779L4 | Lenti-ORF clone of NMRK2 (mGFP-tagged)-Human integrin beta 1 binding protein 3 (ITGB1BP3) |
CNY 5890.00 |
|
| RG210779 | NMRK2 (tGFP-tagged) - Human integrin beta 1 binding protein 3 (ITGB1BP3) |
CNY 5200.00 |
其它ITGB1BP3产品
