IL28B (IFNL3) (NM_172139) Human Untagged Clone

CAT#: SC306726

IFNL3 (untagged)-Human interleukin 28B (interferon, lambda 3) (IL28B)



  "NM_172139" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal IL-28B Antibody
    • 100 ug

CNY 5808.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IFN-lambda-3; IFN-lambda-4; IL-28B; IL-28C; IL28B; IL28C
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>SC306726 representing NM_172139.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCGGGGACTGCATGCCAGTGCTGGTGCTGATGGCCGCAGTGCTGACCGTGACTGGAGCAGTTCCT
GTCGCCAGGCTCCGCGGGGCTCTCCCGGATGCAAGGGGCTGCCACATAGCCCAGTTCAAGTCCCTGTCT
CCACAGGAGCTGCAGGCCTTTAAGAGGGCCAAAGATGCCTTAGAAGAGTCGCTTCTGCTGAAGGACTGC
AAGTGCCGCTCCCGCCTCTTCCCCAGGACCTGGGACCTGAGGCAGCTGCAGGTGAGGGAGCGCCCCGTG
GCTTTGGAGGCTGAGCTGGCCCTGACGCTGAAGGTTCTGGAGGCCACCGCTGACACTGACCCAGCCCTG
GGGGATGTCTTGGACCAGCCCCTTCACACCCTGCACCATATCCTCTCCCAGCTCCGGGCCTGTATCCAG
CCTCAGCCCACGGCAGGGCCCAGGACCCGGGGCCGCCTCCACCATTGGCTGCACCGGCTCCAGGAGGCC
CCAAAAAAGGAGTCCCCTGGCTGCCTCGAGGCCTCTGTCACCTTCAACCTCTTCCGCCTCCTCACGCGA
GACCTGAATTGTGTTGCCAGCGGGGACCTGTGTGTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_172139
Insert Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172139.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172139.2
RefSeq Size 595 bp
RefSeq ORF 591 bp
Locus ID 282617
UniProt ID Q8IZI9
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
MW 21.7 kDa
Gene Summary This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate 5' terminal exon resulting in a novel 5' UTR, and the use of a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus, and contains a signal peptide, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...