HNF 4 alpha (HNF4A) (NM_175914) Human Untagged Clone
CAT#: SC307054
HNF4A (untagged)-Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 4
CNY 3656.00
CNY 7220.00
Cited in 1 publication. |
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF-14; TCF14 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_175914 edited
ATGGTCAGCGTGAACGCGCCCCTCGGGGCTCCAGTGGAGAGTTCTTACGACACGTCCCCA TCAGAAGGCACCAACCTCAACGCGCCCAACAGCCTGGGTGTCAGCGCCCTGTGTGCCATC TGCGGGGACCGGGCCACGGGCAAACACTACGGTGCCTCGAGCTGTGACGGCTGCAAGGGC TTCTTCCGGAGGAGCGTGCGGAAGAACCACATGTACTCCTGCAGATTTAGCCGGCAGTGC GTGGTGGACAAAGACAAGAGGAACCAGTGCCGCTACTGCAGGCTCAAGAAATGCTTCCGG GCTGGCATGAAGAAGGAAGCCGTCCAGAATGAGCGGGACCGGATCAGCACTCGAAGGTCA AGCTATGAGGACAGCAGCCTGCCCTCCATCAATGCGCTCCTGCAGGCGGAGGTCCTGTCC CGACAGATCACCTCCCCCGTCTCCGGGATCAACGGCGACATTCGGGCGAAGAAGATTGCC AGCATCGCAGATGTGTGTGAGTCCATG:AAGGAGCAGCTGCTGGTTCTCGTTGAGTGGGC CAAGTACATCCCAGCTTTCTGCGAGCTCCCCCTGGACGACCAGGTGGCCCTGCTCAGAGC CCATGCTGGCGAGCACCTGCTGCTCGGAGCCACCAAGAGATCCATGGTGTTCAAGGACGT GCTGCTCCTAGGCAATGACTACATTGTCCCTCGGCACTGCCCGGAGCTGGCGGAGATGAG CCGGGTGTCCATACGCATCCTTGACGAGCTGGTGCTGCCCTTCCAGGAGCTGCAGATCGA TGACAATGAGTATGCCTACCTCAAAGCCATCATCTTCTTTGACCCAGATGCCAAGGGGCT GAGCGATCCAGGGAAGATCAAGCGGCTGCGTTCCCAGGTGCAGGTGAGCTTGGAGGACTA CATCAACGACCGCCAGTATGACTCGCGTGGCCGCTTTGGAGAGCTGCTGCTGCTGCTGCC CACCTTGCAGAGCATCACCTGGCAGATGATCGAGCAGATCCAGTTCATCAAGCTCTTCGG CATGGCCAAGATTGACAACCTGTTGCAGGAGATGCTGCTGGGAGGGTCCCCCAGCGATGC ACCCCATGCCCACCACCCCCTGCACCCTCACCTGATGCAGGAACATATGGGAACCAACGT CATCGTTGCCAACACAATGCCCACTCACCTCAGCAACGGACAGATGTGTGAGTGGCCCCG ACCCAGGGGACAGGCAGCCACCCCTGAGACCCCACAGCCCTCACCGCCAGGTGGCTCAGG GTCTGAGCCCTATAAGCTCCTGCCGGGAGCCGTCGCCACAATCGTCAAGCCCCTCTCTGC CATCCCCCAGCCGACCATCACCAAGCAGGAAGTTATCTAG |
Restriction Sites | Please inquire |
ACCN | NM_175914 |
Insert Size | 1360 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_175914.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_175914.3, NP_787110.2 |
RefSeq Size | 1369 bp |
RefSeq ORF | 1359 bp |
Locus ID | 3172 |
UniProt ID | P41235 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Nuclear Hormone Receptor, Transcription Factors |
Protein Pathways | Maturity onset diabetes of the young |
Gene Summary | The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (5) contains an alternate 5' terminal exon, which results in translation initiation from an alternate upstream start codon compared to variant 2. The resulting shorter isoform (5, also known as HNF4alpha8) has a distinct N-terminus compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Hepatocyte nuclear factor-4{alpha} regulates the human organic anion transporter 1 gene in the kidney
,Ken Ogasawara, Tomohiro Terada, Jun-Ichi Asaka, Toshiya Katsura, and Ken-Ichi Inui,
Am J Physiol Renal Physiol. 2007 Jun;292(6):F1819-26.
[HNF4A]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216531 | HNF4A (Myc-DDK-tagged)-Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 4 |
CNY 5488.00 |
|
RC216531L1 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 4, Myc-DDK-tagged |
CNY 7888.00 |
|
RC216531L2 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 4, mGFP tagged |
CNY 5890.00 |
|
RC216531L3 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 4, Myc-DDK-tagged |
CNY 5890.00 |
|
RC216531L4 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 4, mGFP tagged |
CNY 7888.00 |
|
RG216531 | HNF4A (tGFP-tagged) - Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 4 |
CNY 7088.00 |
其它HNF 4 alpha产品