Integrin beta 4 binding protein (EIF6) (NM_181466) Human Untagged Clone

CAT#: SC307281

EIF6 (untagged)-Human eukaryotic translation initiation factor 6 (EIF6), transcript variant 4



  "NM_181466" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-EIF6 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms b(2)gcn; CAB; eIF-6; EIF3A; ITGB4BP; p27(BBP); p27BBP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_181466, the custom clone sequence may differ by one or more nucleotides
ATGGCGGTCCGAGCTTCGTTCGAGAACAACTGTGAGATCGGCTGCTTTGCCAAGCTCACC
AACACCTACTGTCTGGTAGCGATCGGAGGCTCAGAGAACTTCTACAGGTGCGGCGGGAGC
CCCGGGGCTTACGGTGGCGGGGAGGCGTGCGCAGGAGTCAAGAGCTCCGGCAGTGGGAGG
GTGCCGGCCCCTCTGCCCCGCCACCACCGAGTCCATGTCCCTACAGTGTGTTCGAGGGCG
AGCTCTCCGATACCATCCCCGTGGTGCACGCGTCTATCGCCGGCTGCCGCATCATCGGGC
GCATGTGTGTGGGAGACAGAAGAAATTCTGGCAGATGTGCTCAAGGTGGAAGTCTTCAGA
CAGACAGTGGCCGACCAGGTGCTAGTAGGAAGCTACTGTGTCTTCAGCAATCAGGGAGGG
CTGGTGCATCCCAAGACTTCAATTGAAGACCAGGATGAGCTGTCCTCTCTTCTTCAAGTC
CCCCTTGTGGCGGGGACTGTGAACCGAGGCAGTGAGGTGATTGCTGCTGGGATGGTGGTG
AATGACTGGTGTGCCTTCTGTGGCCTGGACACAACCAGCACAGAGCTGTCAGTGGTGGAG
AGTGTCTTCAAGCTGAATGAAGCCCAGCCTAGCACCATTGCCACCAGCATGCGGGATTCC
CTCATTGACAGCCTCACCTGA
Restriction Sites Please inquire     
ACCN NM_181466
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181466.1, NP_852131.1
RefSeq Size 1057 bp
RefSeq ORF 681 bp
Locus ID 3692
UniProt ID P56537
Protein Families Druggable Genome
Gene Summary Hemidesmosomes are structures which link the basal lamina to the intermediate filament cytoskeleton. An important functional component of hemidesmosomes is the integrin beta-4 subunit (ITGB4), a protein containing two fibronectin type III domains. The protein encoded by this gene binds to the fibronectin type III domains of ITGB4 and may help link ITGB4 to the intermediate filament cytoskeleton. The encoded protein, which is insoluble and found both in the nucleus and in the cytoplasm, can function as a translation initiation factor and prevent the association of the 40S and 60S ribosomal subunits. Multiple non-protein coding transcript variants and variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (4) contains an alternate segment compared to variant 1, which causes a frameshift, and lacks an alternate exon, which corrects the frameshift, compared to variant 1. The resulting isoform (c) lacks an internal segment compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Integrin beta 4 binding protein产品

Customer Reviews 
Loading...