TMEM119 (NM_181724) Human Untagged Clone
CAT＃: SC307355
TMEM119 (untagged)-Human transmembrane protein 119 (TMEM119)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | OBIF |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_181724 edited
CTGGGGGCACCATGGTTTCGGCGGCAGCCCCCAGCCTCCTCATCCTTCTGTTGCTGCTCC TGGGGTCTGTGCCTGCTACCGACGCCCGCTCTGTGCCCCTGAAGGCCACGTTCCTGGAGG ATGTGGCGGGTAGTGGGGAAGCCGAGGGCTCGTCGGCCTCCTCCCCGAGCCTCCCGCCAC CCTGGACCCCGGCCCTCAGCCCCACATCGATGGGGCCCCAGCCCACAACCCTGGGGGGCC CATCACCCCCCACCAACTTCCTGGATGGGATAGTGGACTTCTTCCGCCAGTACGTGATGC TGATTGCTGTGGTGGGCTCCCTGGCCTTTCTGCTGATGTTCATCGTCTGTGCCGCGGTCA TCACCCGGCAGAAGCAGAAGGCCTCGGCCTATTACCCATCGTCCTTCCCCAAGAAGAAGT ACGTGGACCAGAGTGACCGGGCCGGGGGCCCCCGGGCCTTCAGTGAGGTCCCCGACAGAG CCCCCGACAGCAGGCCCGAGGAAGCCCTGGATTCCTCCCGGCAGCTCCAGGCCGACATCT TGGCCGCCACCCAGAACCTCAAGTCCCCCACCAGGGCTGCACTGGGCGGTGGGGACGGAG CCAGGATGGTGGAGGGCAGGGGCGCAGAGGAAGAGGAGAAGGGCAGCCAGGAGGGGGACC AGGAAGTCCAGGGACATGGGGTCCCAGTGGAGACACCAGAGGCGCAGGAGGAGCCGTGCT CAGGGGTCCTTGAGGGGGCTGTGGTGGCCGGTGAGGGCCAAGGGGAGCTGGAAGGGTCTC TCTTGTTAGCCCAGGGTGCCCAGGGACCAGTGGGTCCCCCCGAAAGCCCCTGTGCTTGCA GCAGTGTCCACCCCAGTGTCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_181724 |
| Insert Size | 900 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF was fully sequenced and it matches with NM_181724.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181724.1, NP_859075.1 |
| RefSeq Size | 2586 bp |
| RefSeq ORF | 852 bp |
| Locus ID | 338773 |
| UniProt ID | Q4V9L6 |
| Protein Families | Transmembrane |
| Gene Summary | Plays an important role in bone formation and normal bone mineralization. Promotes the differentiation of myoblasts into osteoblasts (PubMed:20025746). May induce the commitment and differentiation of myoblasts into osteoblasts through an enhancement of BMP2 production and interaction with the BMP-RUNX2 pathway. Upregulates the expression of ATF4, a transcription factor which plays a central role in osteoblast differentiation. Essential for normal spermatogenesis and late testicular differentiation (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224098 | TMEM119 (Myc-DDK-tagged)-Human transmembrane protein 119 (TMEM119) |
CNY 3600.00 |
|
| RC224098L1 | Lenti ORF clone of Human transmembrane protein 119 (TMEM119), Myc-DDK-tagged |
CNY 6000.00 |
|
| RC224098L2 | Lenti ORF clone of Human transmembrane protein 119 (TMEM119), mGFP tagged |
CNY 5890.00 |
|
| RC224098L3 | Lenti ORF clone of Human transmembrane protein 119 (TMEM119), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC224098L4 | Lenti ORF clone of Human transmembrane protein 119 (TMEM119), mGFP tagged |
CNY 5890.00 |
|
| RG224098 | TMEM119 (tGFP-tagged) - Human transmembrane protein 119 (TMEM119) |
CNY 4370.00 |
其它TMEM119产品
