GPX6 (NM_182701) Human Untagged Clone

CAT#: SC307486

GPX6 (untagged)-Human glutathione peroxidase 6 (olfactory) (GPX6) (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)



  "NM_182701" in other vectors (3)

CNY 3816.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Synonyms dJ1186N24; dJ1186N24.1; GPx-6; GPX5p; GPXP3; GSHPx-6
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_182701 edited
GTCGTCTAAAACTCCTAGCCATGTTCCAGCAGTTCCAGGCCTCCTGTCTTGTCCTGTTTT
TCCTGGTTGGCTTTGCTCAGCAGACCCTAAAGCCTCAAAATAGGAAGGTGGATTGCAACA
AAGGGGTAACAGGCACCATCTATGAGTATGGAGCCCTCACCCTCAACGGCGAGGAGTACA
TCCAATTCAAGCAGTTTGCAGGCAAGCACGTCCTGTTTGTCAATGTGGCCGCCTATTGAG
GCTTGGCAGCTCAGTATCCTGAACTGAATGCACTACAGGAGGAGCTGAAGAATTTTGGTG
TCATTGTGTTGGCCTTTCCCTGCAACCAGTTTGGAAAACAAGAACCAGGAACAAACTCAG
AAATACTTCTTGGTCTCAAGTATGTGTGTCCAGGTAGTGGCTTTGTCCCCAGTTTCCAGC
TCTTTGAGAAAGGGGATGTGAATGGAGAAAAAGAACAGAAGGTCTTTACTTTCCTGAAGA
ACTCCTGCCCTCCGACCTCTGATCTTTTGGGCTCATCAAGCCAACTCTTCTGGGAGCCCA
TGAAGGTCCATGATATCCGCTGGAACTTTGAGAAATTTCTGGTGGGGCCCGATGGAGTCC
CTGTCATGCATTGGTTCCACCAGGCTCCAGTCAGCACAGTCAAGTCAGACATCCTGGAGT
ACCTAAAGCAGTTCAATACCCACTAGGAAGGGCTAGCGACTGACAGAAATAACTACCCTG
TCTCCCACCTGCAGGAATGTCTAACAAAGCATCCATCTTCCTCCTTCTTTGCTCCACACT
CGTGCCTACCCAGCCTCCTGATGACCAAACCATCCTGTACTACCCAAGCACCTGCTTAGC
ATGTGTGTGTAGCTGTGTGTGTGTGTG
Restriction Sites Please inquire     
ACCN NM_182701
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_182701.1, NP_874360.1
RefSeq Size 1712 bp
Locus ID 257202
UniProt ID P59796
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Arachidonic acid metabolism, Glutathione metabolism
Gene Summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. Expression of this gene has been observed in embryos and olfactory epithelium; however, the exact function of this gene is not known. This isozyme is a selenoprotein in humans, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The orthologs of this gene in mouse and rat (and some other species) contain a cysteine (Cys) residue in place of the Sec residue, and their corresponding mRNAs lack SECIS element. [provided by RefSeq, Jul 2017]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...