CREM (NM_182719) Human Untagged Clone
CAT#: SC307495
CREM (untagged)-Human cAMP responsive element modulator (CREM), transcript variant 6
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CREM-2; hCREM-2; ICER |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_182719 edited
AGTTCTGTCTGCAGAAGCCCATTATGGCTGTAACTGGAGATGACACAGATGAGGAAACTG AACTTGCCCCAAGTCACATGGCTGCTGCCACTGGTGACATGCCAACTTACCAGATCCGAG CTCCTACTGCTGCTTTGCCACAGGGAGTGGTGATGGCTGCATCGCCCGGAAGTTTGCACA GTCCCCAGCAGCTGGCAGAAGAAGCAACACGCAAACGAGAGCTGAGGCTAATGAAAAACA GGGAAGCTGCCAAAGAATGTCGACGTCGAAAGAAAGAATATGTAAAATGTCTGGAGAGCC GAGTTGCAGTGCTGGAAGTCCAGAACAAGAAGCTTATAGAGGAACTTGAAACCTTGAAAG ACATTTGTTCTCCCAAAACAGATTACTAGAAATATTTAACTATGAACTGAAGGCAGCATG TATAGTTGCTTTTGAAGGAATACAATATATAGCTGGCAAGAATGGTGGCTTCTTTTCTT |
Restriction Sites | Please inquire |
ACCN | NM_182719 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This construct is a cloned PCR fragment that was fully sequenced. The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_182719.1, NP_874388.1 |
RefSeq Size | 1589 bp |
RefSeq ORF | 366 bp |
Locus ID | 1390 |
UniProt ID | Q03060 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6), also known as ICER11 and hCREM 2beta-a, uses an alternative downstream promoter, and differs in the 5' UTR and 5' coding region, compared to variant 1. This results in a shorter isoform (6, also known as f) with a distinct N-terminus, compared to isoform 1. This isoform represents one of the early repressor ICER isoforms. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217044 | CREM (Myc-DDK-tagged)-Human cAMP responsive element modulator (CREM), transcript variant 6 |
CNY 1200.00 |
|
RC217044L1 | Lenti ORF clone of Human cAMP responsive element modulator (CREM), transcript variant 6, Myc-DDK-tagged |
CNY 3600.00 |
|
RC217044L2 | Lenti ORF clone of Human cAMP responsive element modulator (CREM), transcript variant 6, mGFP tagged |
CNY 5890.00 |
|
RC217044L3 | Lenti ORF clone of Human cAMP responsive element modulator (CREM), transcript variant 6, Myc-DDK-tagged |
CNY 5890.00 |
|
RC217044L4 | Lenti ORF clone of Human cAMP responsive element modulator (CREM), transcript variant 6, mGFP tagged |
CNY 5890.00 |
|
RG217044 | CREM (tGFP-tagged) - Human cAMP responsive element modulator (CREM), transcript variant 6 |
CNY 2800.00 |