Dectin 1 (CLEC7A) (NM_197947) Human Untagged Clone

CAT#: SC307610

CLEC7A (untagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 1



  "NM_197947" in other vectors (6)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
Rabbit Polyclonal CLEC7A Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_197947 edited
CTCTCAAGAACAATGGAATATCATCCTGATTTAGAAAATTTGGATGAAGATGGATATACT
CAATTACACTTCGACTCTCAAAGCAATACCAGGATAGCTGTTGTTTCAGAGAAAGGATCG
TGTGCTGCATCTCCTCCTTGGCGCCTCATTGCTGTAATTTTGGGAATCCTATGCTTGGTA
ATACTGGTGATAGCTGTGGTCCTGGGTACCATGGCTATTTGGAGATCCAATTCAGGAAGC
AACACATTGGAGAATGGCTACTTTCTATCAAGAAATAAAGAGAACCACAGTCAACCCACA
CAATCATCTTTAGAAGACAGTGTGACTCCTACCAAAGCTGTCAAAACCACAGGGGTTCTT
TCCAGCCCTTGTCCTCCTAATTGGATTATATATGAGAAGAGCTGTTATCTATTCAGCATG
TCACTAAATTCCTGGGATGGAAGTAAAAGACAATGCTGGCAACTGGGCTCTAATCTCCTA
AAGATAGACAGCTCAAATGAATTGGGATTTATAGTAAAACAAGTGTCTTCCCAACCTGAT
AATTCATTTTGGATAGGCCTTTCTCGGCCCCAGACTGAGGTACCATGGCTCTGGGAGGAT
GGATCAACATTCTCTTCTAACTTATTTCAGATCAGAACCACAGCTACCCAAGAAAACCCA
TCTCCAAATTGTGTATGGATTCACGTGTCAGTCATTTATGACCAACTGTGTAGTGTGCCC
TCATATAGTATTTGTGAGAAGAAGTTTTCAATGTAA
Restriction Sites Please inquire     
ACCN NM_197947
Insert Size 744 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation It is not a varient. ORF exactly matches with reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_197947.1, NP_922938.1
RefSeq Size 2592 bp
RefSeq ORF 744 bp
Locus ID 64581
UniProt ID Q9BXN2
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. The encoded glycoprotein is a small type II membrane receptor with an extracellular C-type lectin-like domain fold and a cytoplasmic domain with an immunoreceptor tyrosine-based activation motif. It functions as a pattern-recognition receptor that recognizes a variety of beta-1,3-linked and beta-1,6-linked glucans from fungi and plants, and in this way plays a role in innate immune response. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variant 1 has been alternatively referred to as variant 2 and isoform a has been alternatively referred to as alpha in the literature.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...