Ceramide synthase 1 (CERS1) (NM_198207) Human Untagged Clone
CAT#: SC307648
CERS1 (untagged)-Human LAG1 homolog, ceramide synthase 1 (LASS1), transcript variant 2
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EPM8; GDF-1; GDF1; LAG1; LASS1; UOG1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307648 representing NM_198207.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCGGCGGGGCCCGCGGCGGGGCCGACGGGGCCCGAGCCCATGCCGAGCTACGCGCAGCTAGTG CAGCGCGGCTGGGGCAGCGCGCTGGCGGCGGCGCGGGGCTGCACGGACTGCGGCTGGGGGCTGGCGCGT CGCGGCCTGGCTGAGCACGCGCACCTGGCGCCGCCCGAGCTGCTGCTGCTGGCGCTCGGCGCGCTGGGC TGGACCGCCCTGCGCTCCGCGGCCACTGCGCGCCTCTTTCGGCCCCTGGCGAAGCGGTGCTGCCTCCAG CCCAGAGATGCCGCCAAGATGCCCGAGAGCGCTTGGAAGTTTCTCTTCTACCTGGGCAGCTGGAGCTAC AGTGCCTACCTGCTGTTTGGCACCGACTACCCCTTCTTCCATGACCCACCATCTGTCTTCTACGACTGG ACGCCGGGCATGGCAGTGCCACGGGACATTGCAGCCGCCTACCTGCTCCAGGGAAGCTTCTATGGCCAC TCCATCTACGCTACGCTATACATGGACACCTGGCGCAAGGACTCGGTGGTCATGCTGCTCCACCACGTG GTCACTCTCATCCTCATCGTCTCCTCCTACGCCTTCCGGTACCACAATGTGGGCATCCTTGTGCTCTTC CTGCACGATATCAGTGACGTGCAGCTTGAGTTCACCAAGCTCAACATTTACTTCAAGTCCCGCGGCGGC TCCTACCATCGGCTGCATGCCTTGGCAGCAGACTTGGGCTGCCTCAGCTTCGGCTTCAGCTGGTTCTGG TTCCGCCTCTACTGGTTCCCGCTCAAGGTCCTGTATGCCACCAGTCACTGCAGTCTGCGCACGGTGCCT GACATCCCCTTCTACTTCTTCTTCAATGCGCTCCTGCTGCTGCTCACCCTTATGAACCTCTACTGGTTC CTGTACATCGTGGCGTTTGCAGCCAAGGTGTTGACAGGCCAGGTGCACGAGCTGAAGGACCTGCGGGAG TATGACACAGCCGAGGCCCAGAGCCTGAAGCCCAGCAAAGCCGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_198207 |
Insert Size | 1014 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_198207.2 |
RefSeq Size | 2137 bp |
RefSeq ORF | 1014 bp |
Locus ID | 10715 |
UniProt ID | P27544 |
Protein Families | Druggable Genome |
MW | 38 kDa |
Gene Summary | This gene encodes a ceramide synthase enzyme, which catalyzes the synthesis of ceramide, the hydrophobic moiety of sphingolipids. The encoded enzyme synthesizes 18-carbon (C18) ceramide in brain neurons. Elevated expression of this gene may be associated with increased longevity, while decreased expression of this gene may be associated with myoclonus epilepsy with dementia in human patients. This protein is transcribed from a monocistronic mRNA as well as a bicistronic mRNA, which also encodes growth differentiation factor 1. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (2) is a monocistronic CERS1 transcript. Variant 2 uses an alternate splice pattern in the 3' end of the coding region, compared to variant 1. Variant 2 encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205167 | CERS1 (Myc-DDK-tagged)-Human LAG1 homolog, ceramide synthase 1 (LASS1), transcript variant 2 |
CNY 3656.00 |
|
RC205167L1 | Lenti ORF clone of Human LAG1 homolog, ceramide synthase 1 (LASS1), transcript variant 2, Myc-DDK-tagged |
CNY 6056.00 |
|
RC205167L2 | Lenti ORF clone of Human LAG1 homolog, ceramide synthase 1 (LASS1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC205167L3 | Lenti ORF clone of Human LAG1 homolog, ceramide synthase 1 (LASS1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC205167L4 | Lenti ORF clone of Human LAG1 homolog, ceramide synthase 1 (LASS1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG205167 | CERS1 (tGFP-tagged) - Human LAG1 homolog, ceramide synthase 1 (LASS1), transcript variant 2 |
CNY 4370.00 |
其它Ceramide synthase 1产品