MNK1 (MKNK1) (NM_198973) Human Untagged Clone

CAT#: SC307838

MKNK1 (untagged)-Human MAP kinase interacting serine/threonine kinase 1 (MKNK1), transcript variant 2



  "NM_198973" in other vectors (4)

CNY 5610.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
MKNK1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MNK1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307838 representing NM_198973.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTATCTTCTCAAAAGTTGGAAAAACCTATAGAGATGGGCAGTAGCGAACCCCTTCCCATCGCAGAT
GGTGACAGGAGGAGGAAGAAGAAGCGGAGGGGCCGGGCCACTGACTCCTTGCCAGGAAAGTTTGAAGAT
ATGTACAAGCTGACCTCTGAATTGCTTGGAGAGGGAGCCTATGCCAAAGTTCAAGGTGCCGTGAGCCTA
CAGAATGGCAAAGAGTATGCCGTCAAAATCATCGAGAAACAAGCAGGGCACAGTCGGAGTAGGGTGTTT
CGAGAGGTGGAGACGCTGTATCAGTGTCAGGGAAACAAGAACATTTTGGAGCTGATTGAGTTCTTTGAA
GATGACACAAGGTTTTACTTGGTCTTTGAGAAATTGCAAGGAGGTTCCATCTTAGCCCACATCCAGAAG
CAAAAGCACTTCAATGAGCGAGAAGCCAGCCGAGTGGTGCGGGACGTTGCTGCTGCCCTTGACTTCCTG
CATACCAAAGGCATTGCTCATCGTGATCTGAAACCAGAAAATATATTGTGTGAATCTCCAGAAAAGGTG
TCTCCAGTGAAAATCTGTGACTTTGACTTGGGCAGTGGGATGAAACTGAACAACTCCTGTACCCCCATA
ACCACACCAGAGCTGACCACCCCATGTGGCTCTGCAGAATACATGGCCCCTGAGGTAGTGGAGGTCTTC
ACGGACCAGGCCACATTCTACGACAAGCGCTGTGACCTGTGGAGCCTGGGCGTGGTCCTCTACATCATG
CTGAGTGGCTACCCACCCTTCGTGGGTCACTGCGGGGCCGACTGTGGCTGGGACCGGGGCGAGGTCTGC
AGGGTGTGCCAGAACAAGCTGTTTGAAAGCATCCAGGAAGGCAAGTATGAGTTTCCTGACAAGGACTGG
GCACACATCTCCAGTGAAGCCAAAGACCTCATCTCCAAGCTCCTGGTGCGAGATGCAAAGCAGAGACTT
AGCGCCGCCCAAGTTCTGCAGCACCCATGGGTGCAGGGGGAACAGCAGCACAATGGACCTGACGCTCTT
CGCAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_198973
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_198973.3
RefSeq Size 2618 bp
RefSeq ORF 1044 bp
Locus ID 8569
UniProt ID Q9BUB5
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Insulin signaling pathway, MAPK signaling pathway
MW 39.1 kDa
Gene Summary This gene encodes a Ser/Thr protein kinase that interacts with, and is activated by ERK1 and p38 mitogen-activated protein kinases, and thus may play a role in the response to environmental stress and cytokines. This kinase may also regulate transcription by phosphorylating eIF4E via interaction with the C-terminal region of eIF4G. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) lacks two coding exons, and uses an alternate donor splice site at the 5' non-coding exon compared to variant 1. The second missing exon results in a frame-shift, and a shorter isoform (2) with a distinct C-terminus compared to isoform 1. CCDS Note: The coding region has been updated to scale back the N-terminus to one that is more supported by the available transcript data and by conservation across mammals.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...