DDX47 (NM_201224) Human Untagged Clone

CAT#: SC307995

DDX47 (untagged)-Human DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 (DDX47), transcript variant 2



  "NM_201224" in other vectors (4)

CNY 6560.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DDX47 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms E4-DBP; HQ0256; MSTP162; RRP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307995 representing NM_201224.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCACCCGAGGAACACGATTCTCCGACCGAAGCGTCCCAGCCGATTGTGGAAGAGGAGGAAACT
AAAACATTTAAAGACCTGGGTGTGACAGATGTGTTGTGTGAAGCTTGTGACCAGTTGGGATGGACAAAA
CCCACCAAGATCCAGATTGAAGCTATTCCTTTGGCCTTACAAGGTCGTGATATCATTGGGCTTGCAGAA
ACTGGCTCTGGAAAGACAGGCGCCTTTGCTTTGCCCATTCTAAACGCACTGCTGGAGACCCCGCAGCGT
TTGTTTGCCCTAGTTCTTACCCCGACTCGGGAGCTGGCCTTTCAGATCTCAGAGCAGTTTGAAGCCCTG
GGGTCCTCTATTGGAGTGCAGAGTGCTGTGATTGTAGGTGGAATTGATTCAATGTCTCAATCTTTGGCC
CTTGCAAAAAAACCACATATAATAATAGCAACTCCTGGTCGACTGATTGACCACTTGGAAAATACGAAA
GGTTTCAACTTGAGAGCTCTCAAATACTTGGTCATGGATGAAGCCGACCGAATACTGAATATGGATTTT
GAGACAGAGGTTGACAAGATCCTCAAAGTGATTCCTCGAGATCGGAAAACATTCCTCTTCTCTGCCACC
ATGACCAAGAAGGTTCAAAAACTTCAGCGAGCAGCTCTGAAGAATCCTGTGAAATGTGCCGTTTCCTCT
AAATACCAGACAGTTGAAAAATTACAGCAATATTATATTTTTATTCCCTCTAAATTCAAGAGTAAGCGC
CTAGGATCCCTTAATAAGTTTAAGGCCAAGGCCCGTTCCATTCTTCTAGCAACTGACGTTGCCAGCCGA
GGTTTGGACATACCTCATGTAGATGTGGTTGTCAACTTTGACATTCCTACCCATTCCAAGGATTACATC
CATCGAGTAGGTCGAACAGCTAGAGCTGGGCGCTCCGGAAAGGCTATTACTTTTGTCACACAGTATGAT
GTGGAACTCTTCCAGCGCATAGAACACTTAATTGGGAAGAAACTACCAGGTTTTCCAACACAGGATGAT
GAGGTTATGATGCTGACAGAACGCGTCGCTGAAGCCCAAAGGTTTGCCCGAATGGAGTTAAGGGAGCAT
GGAGAAAAGAAGAAACGCTCGCGAGAGGATGCTGGAGATAATGATGACACAGAGGGTGCTATTGGTGTC
AGGAACAAGGTGGCTGGAGGAAAAATGAAGAAGCGGAAAGGCCGTTAA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_201224
Insert Size 1221 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_201224.1
RefSeq Size 1689 bp
RefSeq ORF 1221 bp
Locus ID 51202
UniProt ID Q9H0S4
MW 45.2 kDa
Gene Summary This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene can shuttle between the nucleus and the cytoplasm, and has an RNA-independent ATPase activity. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, as compared to variant 1. The encoded isoform (2) is thus missing an internal segment, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...