MAFA (NM_201589) Human Untagged Clone

CAT#: SC308064

MAFA (untagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) (MAFA)



  "NM_201589" in other vectors (6)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MAFA rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hMafA; INSDM; RIPE3b1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_201589 edited
ATGGCCGCGGAGCTGGCGATGGGCGCCGAGCTGCCCAGCAGCCCGCTGGCCATCGAGTAC
GTCAACGACTTCGACCTGATGAAGTTCGAGGTGAAGAAGGAGCCTCCCGAGGCCGAGCGC
TTCTGCCACCGCCTGCCGCCAGGCTCGCTGTCCTCGACGCCGCTCAGCACGCCCTGCTCC
TCCGTGCCCTCCTCGCCCAGCTTCTGCGCGCCCAGCCCGGGCACCGGCGGCGGCGGCGGC
GCGGGGGGCGGCGGCGGCTCGTCTCAGGCCGGGGGCGCCCCCGGGCCGCCGAGCGGGGGC
CCCGGCGCCGTCGGGGGCACCTCGGGGAAGCCGGCGCTGGAGGATCTGTACTGGATGAGC
GGCTACCAGCATCACCTCAACCCCGAGGCGCTCAACCTGACGCCCGAGGACGCGGTGGAG
GCGCTCATCGGCAGCGGCCACCACGGCGCGCACCACGGCGCGCACCACCCGGCGGCCGCC
GCAGCCTACGAGGCTTTCCGCGGCCCGGGCTTCGCGGGCGGCGGCGGAGCGGACGACATG
GGCGCCGGCCACCACCACGGCGCGCACCACGCCGCCCACCACCACCACGCCGCCCACCAC
CACCACCACCACCACCACCACCATGGCGGCGCGGGACACGGCGGTGGCGCGGGCCACCAC
GTGCGCCTGGAGGAGCGCTTCTCCGACGACCAGCTGGTGTCCATGTCGGTGCGCGAGCTG
AACCGGCAGCTCCGCGGCTTCAGCAAGGAGGAGGTCATCCGGCTCAAGCAGAAGCGGCGC
ACGCTCAAGAACCGCGGCTACGCGCAGTCCTGCCGCTTCAAGCGGGTGCAGCAGCGGCAC
ATTCTGGAGAGCGAGAAGTGCCAACTCCAGAGCCAGGTGGAGCAGCTGAAGCTGGAGGTG
GGGCGCCTGGCCAAAGAGCGGGACCTGTACAAGGAGAAATACGAGAAGCTGGCGGGCCGG
GGCGGCCCCGGGAGCGCGGGCGGGGCCGGTTTCCCGCGGGAGCCTTCGCCGCCGCAGGCC
GGTCCCGGCGGGGCCAAGGGCACGGCCGACTTCTTCCTGTAG
Restriction Sites Please inquire     
ACCN NM_201589
Insert Size 2600 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The final clone matches with NM_201589.2, and its ORF carries a SNP.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_201589.2, NP_963883.2
RefSeq Size 1062 bp
RefSeq ORF 1062 bp
Locus ID 389692
UniProt ID Q8NHW3
Protein Families Druggable Genome, ES Cell Differentiation/IPS
Protein Pathways Maturity onset diabetes of the young, Type II diabetes mellitus
Gene Summary MAFA is a transcription factor that binds RIPE3b, a conserved enhancer element that regulates pancreatic beta cell-specific expression of the insulin gene (INS; MIM 176730) (Olbrot et al., 2002 [PubMed 12011435]).[supplied by OMIM, Mar 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...