CD59 (NM_203330) Human Untagged Clone
CAT#: SC308123
CD59 (untagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 1
CNY 1800.00
| Cited in 1 publication. |
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1F5; 16.3A5; EJ16; EJ30; EL32; G344; HRF-20; HRF20; MAC-IP; MACIF; MEM43; MIC11; MIN1; MIN2; MIN3; MIRL; MSK21; p18-20 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF within SC119785 sequence for NM_000611 edited (data generated by NextGen Sequencing)
ATGGGAATCCAAGGAGGGTCTGTCCTGTTCGGGCTGCTGCTCGTCCTGGCTGTCTTCTGC CATTCAGGTCATAGCCTGCAGTGCTACAACTGTCCTAACCCAACTGCTGACTGCAAAACA GCCGTCAATTGTTCATCTGATTTTGATGCGTGTCTCATTACCAAAGCTGGGTTACAAGTG TATAACAAGTGTTGGAAGTTTGAGCATTGCAATTTCAACGACGTCACAACCCGCTTGAGG GAAAATGAGCTAACGTACTACTGCTGCAAGAAGGACCTGTGTAACTTTAACGAACAGCTT GAAAATGGTGGGACATCCTTATCAGAGAAAACAGTTCTTCTGCTGGTGACTCCATTTCTG GCAGCAGCCTGGAGCCTTCATCCCTAA Clone variation with respect to NM_000611.5 |
| Restriction Sites | Please inquire |
| ACCN | NM_203330 |
| Insert Size | 1900 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_203330.1, NP_976075.1 |
| RefSeq Size | 7794 bp |
| RefSeq ORF | 387 bp |
| Locus ID | 966 |
| UniProt ID | P13987 |
| Protein Families | Druggable Genome |
| Protein Pathways | Complement and coagulation cascades, Hematopoietic cell lineage |
| Gene Summary | This gene encodes a cell surface glycoprotein that regulates complement-mediated cell lysis, and it is involved in lymphocyte signal transduction. This protein is a potent inhibitor of the complement membrane attack complex, whereby it binds complement C8 and/or C9 during the assembly of this complex, thereby inhibiting the incorporation of multiple copies of C9 into the complex, which is necessary for osmolytic pore formation. This protein also plays a role in signal transduction pathways in the activation of T cells. Mutations in this gene cause CD59 deficiency, a disease resulting in hemolytic anemia and thrombosis, and which causes cerebral infarction. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the same protein as variants 2-8. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Stability and Bioactivity of Chitosan as a Transfection Agent in Primary Human Cell Cultures: A Case for Chitosan-only Controls
,Cupino, TL;Watson, BA;Cupino, AC;Cupino, AC;Ghamsary, MG;Soriano, S;Kirsch, Wf;,
Carbohydrate Polymers
,PubMed ID 29103517
[CD59]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218452 | CD59 (Myc-DDK-tagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 1 |
CNY 1800.00 |
|
| RC218452L1 | Lenti-ORF clone of CD59 (Myc-DDK-tagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 1 |
CNY 5890.00 |
|
| RC218452L2 | Lenti-ORF clone of CD59 (mGFP-tagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 1 |
CNY 4200.00 |
|
| RC218452L3 | Lenti-ORF clone of CD59 (Myc-DDK-tagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 1 |
CNY 5890.00 |
|
| RC218452L4 | Lenti-ORF clone of CD59 (mGFP-tagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 1 |
CNY 5890.00 |
|
| RG218452 | CD59 (tGFP-tagged) - Human CD59 molecule, complement regulatory protein (CD59), transcript variant 1 |
CNY 4370.00 |
